7900ht fast real time pcr instrument

Manufactured by Thermo Fisher Scientific

Sourced in United States, Japan

The 7900HT Fast Real-Time PCR instrument is a high-performance real-time PCR system designed for rapid and accurate nucleic acid analysis. It features a 96-well sample block, multiple excitation and emission filters, and a sensitive optical detection system. The instrument is capable of conducting fast real-time PCR experiments, providing efficient and reliable data for a wide range of applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

7900HT Fast Real-Time PCR 7900HT real-time PCR instrument 7900HT Fast instrument 7900HT PCR instrument Fast 7900HT 7900HT instrument

28 protocols using 7900ht fast real time pcr instrument

Evaluating RNA Profiles in Small Extracellular Vesicles

Cited 6 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAs in sEVs are mainly composed of miRNAs and mRNAs, and some of these RNAs are critical to tumor progression. Therefore, the proliferation-related mRNAs (TIMP1, IDH1) and miRNAs (miR-19b, miR-21, miR-1246) [[34] , [35] (link), [36] (link), [37] (link)], angiogenesis-related mRNA (VGER) [38 (link)], invasion-related mRNA (EGFR) and miRNAs (miR-20 and miR-320) [[39] (link), [40] (link), [41] (link)], migration-related mRNAs (TGFB1, FGF2) [42 (link)], and drug resistance-related mRNAs (APNG, ABCC3 and BIRC5) were selected [43 (link),44 (link)] for further evaluation of the RNA eliminating efficacies. Equal amount of sEVs (1 × 10¹⁰ particles/mL) were used in each group, and the total RNA was extracted from the sEVs using TRIzol Reagent (Invitrogen) according to the manufacturer's instructions, and the total RNAs were resuspended in the same volume of RNA-free water. cDNA was synthesized using PrimeScript™ RT Master Mix (TaKaRa, Japan) with the same volume of RNA suspension. Reverse transcription was performed on a proflex PCR system (life technology). Quantification of miRNAs and mRNAs expression was performed using a TB Green Premix Ex Taq kit (TaKaRa, Japan) on a 7900HT Fast Real-Time PCR instrument (life technology). The primers of miRNAs and mRNA are listed in supplementary Table 6. All of these reactions were run in triplicate. The data were calculated as 2^-△CT expression.

Guo Y., Hu G., Xia Y., Li H., Yuan J., Zhang J., Chen Y., Guo H., Yang Y., Wang Y, & Deng Z. (2022). Eliminating the original cargos of glioblastoma cell-derived small extracellular vesicles for efficient drug delivery to glioblastoma with improved biosafety. Bioactive Materials, 16, 204-217.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was isolated from hepatocytes plated at a density of 8x10⁵ cells/well in 6 well plates using 0.5 mL of Trizol (Life Technologies) per well, and 1 μg of RNA was used to generate cDNA by the Superscript III reverse transcriptase reagents (Life Technologies). cDNA was diluted to 200 μL (1:10 dilution), and qPCR was performed using an Applied Biosystems 7900HT Fast Real-Time PCR instrument with Syber Green reagents (Life Technologies) to a final volume of 10 μL in 384 well qPCR plates with 3 μL of diluted cDNA (1.5 μL for cyclophilin D control primers) and 300 μM primers for the indicated genes. Gene expression levels were normalized to Cyclophilin D (CycD) using the 2^−ΔΔCt method and are presented as relative transcript levels. The sequence of primers is available in Table S1.

Lane E.A., Choi D.W., Garcia-Haro L., Levine Z.G., Tedoldi M., Walker S, & Danial N.N. (2019). HCF-1 regulates de novo lipogenesis through a nutrient sensitive complex with ChREBP. Molecular cell, 75(2), 357-371.e7.

+ Open protocol

+ Expand

miRNA Expression Analysis in PBMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA templates were synthesized from PBMC total RNA with the TaqMan^® Advanced miRNA cDNA Synthesis Kit (Cat# A28007, Thermofisher, Waltham, MA, USA). All real-time quantitative PCRs were performed by duplicate in a 384-well format (TaqMan^® Low Density Array Cards, TLDAs) on a 7900HT Fast Real-Time PCR Instrument (Thermofisher, Waltham, MA, USA) and using TaqMan^® Fast Advanced Master Mix. The thermal protocol was adjusted for the TaqMan^® Fast AdvancedMaster Mix. IDs for individual Oxstress transcript assays in the cards were as follows: FOXO1 (Hs00231106_m1), MAP2K1 (Hs05512159_s1), MAPK1 (Hs01046830_m1), MAPK9 (Hs01558224_m1), FOS (Hs04194186_s1), EGFR (Hs01076090_m1), CCR7 (Hs01013469_m1), GATA4 (Hs00171403_m1), RNF7 (Hs02621493_s1), GAPDH (Hs99999905_m1), and β-ACTIN (Hs01060665_g1). Hsa_miR-30a-5p expression (Assay ID: 000417) were normalized using has-miR-16-3p (Assay ID:002171) as endogenous reference gene. Expression analysis was performed using the comparative CT (ΔΔCT) method with the Expression Suite software v1.1 (Thermofisher, Waltham, MA, USA) using β-actin as endogenous control for normalization.

Hueso M., Mallén A., Casas Á., Guiteras J., Sbraga F., Blasco-Lucas A., Lloberas N., Torras J., Cruzado J.M, & Navarro E. (2020). Integrated miRNA/mRNA Counter-Expression Analysis Highlights Oxidative Stress-Related Genes CCR7 and FOXO1 as Blood Markers of Coronary Arterial Disease. International Journal of Molecular Sciences, 21(6), 1943.

+ Open protocol

+ Expand

Quantification of hsa-miR-30a-5p in Human Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

PBMCs were isolated less than 2 h after blood collection by Ficoll fractioning (SepMATE^TM PBMC Isolation Tubes, StemCell technologies, Vancouver, BC, Canada). Samples from aorta and perivascular adipose tissue were extracted during the intervention when it was feasible. Total RNA was extracted using the Maxwell RSC miRNA Tissue KIT (Promega, Madison, WI, USA) and cDNA templates synthesized with the TaqMan^® Advanced miRNA cDNA Synthesis Kit (Cat# A28007, Thermofisher, Waltham, MA, USA). All real-time quantitative PCRs were performed by triplicate on a 7900HT Fast Real-Time PCR Instrument (ThermoFisher, Waltham, MA, USA) and using TaqMan^® Fast Advanced Master Mix. Expression analysis was performed using the comparative CT (ΔΔCT) method using β-actin as an endogenous control for normalization. Hsa-miR-30a-5p expression was normalized using hsa-miR-16-3p as an endogenous reference gene and 100 pmol/mL of exogenous cel-miR-54.

Casas A., Mallén A., Blasco-Lucas A., Sbraga F., Guiteras J., Bolaños N., Castaño E., Torras J., Cruzado J.M., Navarro E, & Hueso M. (2020). Chronic Kidney Disease-Associated Inflammation Increases the Risks of Acute Kidney Injury and Mortality after Cardiac Surgery. International Journal of Molecular Sciences, 21(24), 9689.

+ Open protocol

+ Expand

CLL PBMC Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA and RNA were extracted from CLL PBMC samples using a standard kit according to the manufacturer’s protocol (Qiagen, Hilden, Germany). cDNA synthesis was performed using the Superscript III FS synthesis supermix kit (Life technologies, Carlsbad, USA) according to the manufacturer’s protocol. Real-time PCR was performed using the Power SYBR Green PCR master mix and the 7900HT fast real-time PCR instrument (Applied Biosystems, Warrington, UK). qRT-PCR primers were designed with PRIMER3 (Broad Institute). The GAPDH gene was used as an internal loading control gene. The relative expression levels were calculated using the ΔΔCt method. All primers sequences are listed in Supplemental Table 2.

Kosalai S.T., Morsy M.H., Papakonstantinou N., Mansouri L., Stavroyianni N., Kanduri C., Stamatopoulos K., Rosenquist R, & Kanduri M. (2019). EZH2 upregulates the PI3K/AKT pathway through IGF1R and MYC in clinically aggressive chronic lymphocytic leukaemia. Epigenetics, 14(11), 1125-1140.

+ Open protocol

+ Expand

Real-Time qPCR Analysis of LAMP-2 Isoforms

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolation of total messenger RNA (mRNA) was performed in cell pellets using the RNeasy Mini kit (Qiagen, Hilden, Germany), and reverse transcription was performed using 500 ng of total RNA and a High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific) according to manufacturer’s instructions. Real-time PCR was carried out using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) and a 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Waltham, MA, USA) using LAMP-2A primers (Fw: GGGTTCAGCCTTTCAATGTG, Rev: CAGCATGATGGTGCTTGAGA), LAMP-2B primers (Fw: GGGTTCAGCCTTTCAATGTG and Rev: CCTGAAAGACCAGCACCAAC), and LAMP-2C primers (Fw: GTATTCTACAGCTGAAGAATGTTCTG and Rev: ACACCCACTGCAACAGGAAT). HPRT (Fw: TTATGGACAGGACTGAACGTCTTG, Rev: GCACACAGAGGGCTACAATGTG) and UBE2D2 (Fw: TGCCTGAGATTGCTCGGATCT, Rev: TCGCATACTTCTGAGTCCATTCC) were used as reference genes. Quantification was performed using the comparative CT method. All the samples were tested in triplicate and the relative expression values were normalized to the expression value of HPRT and UBE2D2. The fold change was calculated using the 2^-ΔCt method. Three independent experiments with differentiated cells were performed.

Navarro-Romero A., Fernandez-Gonzalez I., Riera J., Montpeyo M., Albert-Bayo M., Lopez-Royo T., Castillo-Sanchez P., Carnicer-Caceres C., Arranz-Amo J.A., Castillo-Ribelles L., Pradas E., Casas J., Vila M, & Martinez-Vicente M. (2022). Lysosomal lipid alterations caused by glucocerebrosidase deficiency promote lysosomal dysfunction, chaperone-mediated-autophagy deficiency, and alpha-synuclein pathology. NPJ Parkinson's Disease, 8, 126.

+ Open protocol

+ Expand

Quantifying mRNA and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

First-strand cDNA was synthesized from 1000 ng of total RNA using the SuperScript III first strand synthesis supermix (Thermo Fisher Scientific) with oligo(dT) primers. Predesigned dual-labeled qPCR probes and primers for mRNA quantification were ordered from Integrated DNA Technologies (see Supplemental Table 11 for sequences). Real-time PCR was performed using the KAPA probe fast 2× master mix (KAPA biosystems) in a 7900HT Fast real-time PCR instrument (Applied Biosystems). TaqMan miRNA assays for let-7 family members and U6 snRNA (Rnu6) were purchased from Applied Biosystems and used according to the manufacturer's instructions. C_T values from triplicate samples were averaged, and relative expression was calculated using the 2^−ΔΔCT method.

Wang S., Chim B., Su Y., Khil P., Wong M., Wang X., Foroushani A., Smith P.T., Liu X., Li R., Ganesan S., Kanellopoulou C., Hafner M, & Muljo S.A. (2019). Enhancement of LIN28B-induced hematopoietic reprogramming by IGF2BP3. Genes & Development, 33(15-16), 1048-1068.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was reverse-transcribed using the high capacity cDNA reverse transcription kit (Applied Biosystems, Thermo Fisher). TaqManTM RT-PCR gene expression assays (summarized in the Appendix A, Table A1) were performed on a 7900HT Fast Real Time PCR instrument (Applied Biosystems). Assays were run in triplicate on 96-well plates. Sixteen known reference genes were screened on 384-well micro fluidic cards with the TaqMan Endogenous Control Card (Applied Biosystems, catalog number 4367563). Data are represented as Ct values which are inversely proportional to target cDNA copy numbers in the PCR reactions, i.e., to transcript quantities. Calculations of fold differences were based on equal amounts of total RNA employed in each reverse transcription reaction.

Coulibaly A., Velásquez S.Y., Sticht C., Figueiredo A.S., Himmelhan B.S., Schulte J., Sturm T., Centner F.S., Schöttler J.J., Thiel M, & Lindner H.A. (2019). AKIRIN1: A Potential New Reference Gene in Human Natural Killer Cells and Granulocytes in Sepsis. International Journal of Molecular Sciences, 20(9), 2290.

+ Open protocol

+ Expand

Genotyping of GPR65 SNPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping of SNPs was performed using TaqMan allelic discrimination assays (TaqMan SNP Genotyping Assays C_1928636_10, C_1928640_1_ and C_11667238_10 for the SNPs rs8005161, rs3742704 and rs1805078, respectively, all from Applied Biosystems, Thermo Fisher Scientific, USA) on a 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Rotkreuz, Switzerland) using the following cycling conditions: 10 min at 95 °C, 45 cycles of 95 °C for 15 s, and 60 °C for 1 min. Ten nanograms of each genomic DNA was used per PCR reaction in a volume of 5 μl.
The presence of either major or minor alleles of each subject participating in the cAMP and RhoA functional GPR65 assays was confirmed by Taqman genotyping (rs8005161, C_1928636_10 TaqMan SNP Genotyping Assay).

Tcymbarevich I.V., Eloranta J.J., Rossel J.B., Obialo N., Spalinger M., Cosin-Roger J., Lang S., Kullak-Ublick G.A., Wagner C.A., Scharl M., Seuwen K., Ruiz P.A., Rogler G., de Vallière C, & Misselwitz B. (2019). The impact of the rs8005161 polymorphism on G protein-coupled receptor GPR65 (TDAG8) pH-associated activation in intestinal inflammation. BMC Gastroenterology, 19, 2.

+ Open protocol

+ Expand

Real-Time PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For real-time RT-PCR analysis of gene expression, cMPs and BMDMs were collected and total RNA was isolated using an RNeasy Mini Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. cDNA was synthetized using qScript cDNA Supermix (Quanta, Gaithersburg, MD) and real-time PCR analysis was performed on the 7900HT Fast Real-Time PCR instrument (Applied Biosystems, Grand Island, NY) using FAM-labeled gene-specific probes and primers (Applied Biosystems). The level of target gene expression was calculated as 2^−ΔCt where ΔCt = Ct_target − Ct_GAPDH with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as endogenous control and Ct indicating threshold cycle.

Filardy A.A., He J., Bennink J., Yewdell J, & Kelsall B.L. (2015). Post-transcriptional control of NLRP3 inflammasome activation in colonic macrophages. Mucosal immunology, 9(4), 850-858.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!