Rotor gene q 6plex system

Cultured calli were harvested and promptly transferred to liquid nitrogen for enhanced RNA isolation before being stored at −80 °C until RNA extraction. The RNA extraction utilized the RNeasy Plant Mini Kit (Qiagen), followed by mRNA quantification using a DeNovix Spectrophotometer (DeNovix Inc., Wilmington, NC, USA). Subsequent steps involved synthesizing complementary DNA (cDNA) with the ReverTra AceTM qPCR RT Master Mix (Toyobo, Tsuruga, Japan) as per the manufacturer’s protocol. For quantitative real-time RT-PCR (qRT-RT-PCR), the reaction mixtures comprised 10 μL of THUNDERBIRDTM Next SYBR^® qPCR Mix (Toyobo), 1 μL each of forward and reverse primers (10 pmol/μL and 10 pmol/mL, respectively), 7 μL of Nuclease-Free Water, and 1 μL of cDNA in a PCR plate. Amplification utilized the Rotor-Gene Q 6plex System (Rotor-Gene Q, Qiagen) involving 40 cycles: denaturation at 95 °C for 15 s, annealing at 62 °C for 1 min, and extension at 72 °C for 1 min. Each plate contained a minimum of three replications. Normalization of target gene expression was performed against the endogenous control gene (RhEF1) using the previously mentioned forward primer GGGTAAGGAGAAGGTTCACATC and reverse primer CAGCCTCCTTCTCAAACCTCT [22 (link)]. Relative expressions were calculated using the formula R = 2^{−[ΔCt sample − ΔCt control]}.

Complementary DNA (cDNA) was synthesized from 2 μg of total RNA using BioFACT 2X RT Pre‐Mix kit (Korea) in a final volume of 20 mL. The reaction was carried out at 25°C for 5 minutes, 50°C for 30 minutes, and 90°C for 5 minutes by Gradient thermocycler PCR (BIO‐RAD, Germany).
qPCR was carried out by SYBR Green Master Mix (Amplicon, Denmark) and Rotor‐Gene Q 6plex System (Qiagen, Germany) in a 20 mL total reaction volume, containing a specific primer set. qPCR was performed in three steps with the following program: for SEPT4 and GAPDH: initial denaturing at 95°C for 15 minutes, 45 cycles of denaturation at 95°C for 15 seconds; primer annealing temperature at 60°C for 30 seconds; and elongation at 72°C for 20 seconds. And for SEPT2: 15 minutes at 95°C, 45 cycles of 15 seconds at 95°C and 30 seconds at 56°C, and 72°C for 20 seconds. Melting curves were obtained and analyzed after each run. The presence of one peak in melting curves and the single bands on agarose gel electrophoresis with appropriate size confirmed the specificity of the amplification. All qPCR reactions were performed in duplicate. The results were analyzed using the Rotor‐Gene Q Series Software 2.3.1 and were converted into threshold cycle values. GAPDH was used as the reference gene for data normalization. Table 2 summarizes the primer sequences and the resulting PCR product length.

The cells treated with HSDP were detached using trypsin and washed with PBS before storage at -80°C until RNA extraction. For this purpose, a minimum of 1 x10⁶ cells per experimental group were processed using the RNeasy Mini kit (#74104; QIAGEN). The mRNA levels were measured with the NanoDrop (DS-11, DeNovix), followed by cDNA synthesis using RT Master Mix (FSQ-201, TOYOBO, Japan) following the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) involved reaction mixtures containing 10 μL THUNDERBIRDTM Next SYBR® qPCR Mix (QPS-201, TOYOBO, Japan), 1 μL (10 pmol/μL) of forward primer, 1 μL (10 pmol/mL) of reverse primer, 7 μL of Nuclease-Free Water, and 1 μL of cDNA in a PCR plate. The amplification was carried out with the Rotor-Gene Q 6plex System (Rotor-Gene Q, Qiagen, Germany) through 40 cycles: denaturation at 95°C for 15 s, annealing at 62°C for 1 min, and extension at 72°C for 1 min. Each plate had at least three replications. The quantification of each target gene expression was standardized against the endogenous control gene (GAPDH) and a list of the primers is shown in S1 Table in S1 File. Relative expressions were calculated using the formula:
$$\mathrm{R}=2^{‐\left[\mathrm{\Delta }\mathrm{C}\mathrm{t}\mathrm{s}\mathrm{a}\mathrm{m}\mathrm{p}\mathrm{l}\mathrm{e}‐\mathrm{\Delta }\mathrm{C}\mathrm{t}\mathrm{c}\mathrm{o}\mathrm{n}\mathrm{t}\mathrm{r}\mathrm{o}\mathrm{l}\right]}$$