Cfx96 touch system

RNA was isolated using TransZol Up (Transgen, Beijing, China). cDNA was synthesized from 1 μg of RNA with the PrimeScriptTM RT-PCR Kit (Takara, Kyoto, Japan). Analysis was performed in a CFX96 Touch system (Bio-Rad, Hercules, California) using SYBR Green Fast kit (Applied Biosystems, Waltham, Massachusetts). rp49 expression was used for normalization. Three experiments per genotype were averaged. A biological replicate was performed with same results. Primers used were:
upd-For: 5′ TCCACACGCACAACTACAAGTTC 3′;
upd-Rev: 5′ CCAGCGCTTTAGGGCAATC 3′;
upd2-For: 5′ AGTGCGGTGAAGCTAAAGACTTG 3′;
upd2-Rev: 5′ GCCCGTCCCAGATATGAGAA 3′;
upd3-For: 5′ TGCCCCGTCTGAATCTCACT 3′;
upd3-Rev: 5′ GTGAAGGCGCCCACGTAA 3′;
rp49-For: 5′ GGCCCAAGATCGTGAAGAAG 3′;
rp49-Rev: 5′ ATTTGTGCGACAGCTTAGCATATC 3′.

We collected 5 blood serum samples from 5 mice and used the whole serum from individual mice to isolate EVs as described above. We extracted total RNA including miRs from 5 EV pellets individually using the miRNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions with minor modification. Briefly, we added 1.5 volume of 100% EtOH to precipitate the total RNA after chloroform cleaning and eluted the RNA using 13 µL water; 1 µL of the RNA sample was used to measure RNA quality and concentration by Nanodrop (Thermo Fisher Scientific, Waltham, MA, USA) and 12 µL of RNA was used to make cDNA by miScript II RT kit, HiFlex buffer (Qiagen). For qPCR, 20 uL of cDNA was diluted by the addition of 200 uL of water. This diluted cDNA was used to evaluate miRs by RT-qPCR using miRScript SYBR kit (Qiagen) according to the manufacturer’s instructions, using the CFX96 Touch System (Bio-Rad) and the thermal profile suggested by the manufacturer. Expression levels of miR-21-5p and -16-5p were quantitatively compared using the ∆C_t method with mean Ct values of SNORD95, SNORD96 and RNU6-2 as reference genes. These data prove that circulating EVs isolated from a single mouse are enough to evaluate small RNAs.

Total RNA was extracted from bPBMC using RNeasy Plus Kit (Qiagen Inc, CA, USA) following manufacturer protocol. Contaminating genomic DNA was removed by additional treatment with RNase-free DNase (Qiagen Inc, CA, USA). The quality and quantity of RNA were analyzed using a NanoDrop Spectrophotometer (Thermo Scientific). cDNA was synthesized from RNA using the Prime script 1^st-strand cDNA synthesis kit (Takara) as per the manufacturer’s instructions and using a mixture of random hexamer and oligo dT primers. Primers were designed for bovine gene targets (IFN-γ, IL-17, TNF-α, IFN-β, IL-1β, IL-6, IL-10, cGAS, STING, TBK1, IRF3, and IRF7) (Supplementary Table S4) using Primer-BLAST (NCBI) and real-time PCR was performed using a CFX96 Touch System (Biorad). Real-time PCR protocol started with an initial denaturation and enzyme activation at 95°C for 2 minutes followed by 40 cycles of denaturation at 95°C for 15 seconds, annealing and extension were carried out for 1 minute at a temperature ranging from 55°C to 65°C (based on the target gene). Melt curve analysis was performed by heating the samples from 65°C to 95°C with an increment of 0.5 and fluorescence was recorded. Relative gene expression of the target genes was calculated using the 2^–ΔΔCT method with RPLP0 as an internal control.

RNA extraction from cell pellets was performed by MagnaNAPpure LC 2.0 System using the MagNAPure RNA isolation kit high performance (Roche), according to the manufacturers’ instructions. To obtain a rough estimate of genomic viral RNA at each time point, RNA preparations (two replicates per condition) were merged into a single RNA pool per condition, then tested by RT–qPCR on a CFX96 Touch system (Bio-Rad Laboratories) with ANDiS FAST SARS-CoV-2 RT–qPCR Detection Kit (3D Biomedicine Science & Technology Co), targeting the protein gene regions N, E, and Orf1ab. RT–qPCR were used to estimate the genomic viral RNA content in each RNA pool on the basis of cycle threshold (Ct) values; samples showing a Ct value ≤ 30 were retrotranscribed and processed for NGS process.
Reverse transcription was performed as described elsewhere (Marcolungo et al, 2021 (link)). Two cDNA preparations were generated from each condition, and amplified using the ARTIC Primers v.1.3 (Marcolungo et al, 2021 (link)). PCR products were cleaned up using 1× AMPure XP beads (Beckman Coulter) and eluted in 15 μl of water. Amplicon libraries, prepared using the KAPA Hyper prep kit (Roche), were analyzed on the 4,150 TapeStation System (Agilent Technologies) and quantified using the Qubit dsDNA HS Assay kit (Thermo Fisher Scientific). Libraries were sequenced on Illumina MiSeq in 250-bp paired-end.

The total RNA from each sample was extracted using NucleoZOL reagent (MACHEREY-NAGEL, Germany) in accordance with the recommended protocol. Retrotranscription was performed with the Reverse Transcriptase M-MLV (Takara, Japan). The RT-PCR reactions were performed with a SYBR Premix Ex Taq™ kit (Takara, Japan) on a Bio-Rad CFX96 Touch system (Bio-Rad, USA). The primers used were as follows: YAP, forward: GGTGCCACTGTTAAGGAAAGG, reverse: GTGAGGCCACAGGAGTTAGC; β-catenin, forward: CATTACAACTCTCCACAACC3, reverse: CAGATAGCACCTTCAGCAC; β-actin, forward: TGGCACCCAGCACAATGAA, reverse: CTAAGTCATAGTCCGCCTAGAAGCA. The data were analyzed using the 2^−ΔΔCt method.