Trizole

White blood cells from patients’ peripheral blood or bone marrow samples were purified using the QIAmp RNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturers protocol and stored in RLT-buffer (Qiagen, Hilden, Germany) or trizole (ThermoFisher Scientific, Waltham, USA) at −80 °C prior to use. Total RNA was isolated from the leukocyte fraction using the mirVana miRNA Isolation Kit (ThermoFisher Scientific) according to manufacturer’s protocol. 200 ng of total RNA were reversely transcribed using Human Megaplex Primer Pools A v.2.1 and TaqMan microRNA Reverse Transcription Kit (ThermoFisher Scientific) on the GeneAmp PCR system 9700 (ThermoFisher Scientific) according to the manufacturer’s recommendations. After pre-amplification of cDNA according to manufacturer’s protocol, the pre-amplified cDNA was loaded on TaqMan Human MicroRNA Cards A v2.1 and analyzed on the ABI Prism 7900HT Sequence Detection System (ThermoFisher Scientific) with default cycling conditions. Expression data of screened miRNAs exhibiting Ct-values < 35 were included into further analysis. MiRNA expression levels were analyzed using the ^ΔΔCt method with U6snRNA as endogenous control [15 (link)]. Fold changes were calculated based on the ratio of the median of non-responders compared to the median of responders for the subsets of samples derived from peripheral blood or bone marrow.

For each treatment group in the survival assays cells from two wells of a 6-well plate were pelleted for further molecular analysis. RNA was isolated by means of Trizole/Chloroform protocol as described previously (Knorr et al., 2021 (link)). In brief, 1 mL Trizole (Thermo Fisher Scientific; #15596026) was added to each cell pellet and cells were disrupted in a tissue lyser. 200 μL Chloroform (Labsolute; #2475) was added and the samples were shaken vigorously for 20 s in tissue lyser. Samples were incubated on ice for 15 min before centrifugation at 12,000 × g for 15 min at 4°C. The top translucent phase of each sample was transferred to a fresh Eppendorf cup and mixed with 1 mL ice-cold 75% EtOH. Samples were incubated at –20°C for at least 1 h before centrifugation at 10,000 × g for 15 min at 4°C. The resulting RNA pellet was washed three times in ice-cold EtOH before pellets were dried and resuspended in 30 μL ddH₂O. RNA concentrations were measured by Nanodrop (Thermo Fisher Scientific).
cDNA was synthesized using the LunaScript RT SuperMixKit (New England BioLabs; #E3010) according to the manufactures instructions. For all samples 1 μg RNA was reverse transcribed.

M. acetivorans C2A wild type was adapted to methanol and acetate for 33 generations. The total RNA was isolated from early exponential phase cultures (OD₆₀₀ = 0.4) using TRIzole (Invitrogen, Carslbad, CA) and the Zymo Direct-zol RNA MiniPrep kits (Zymo Research, Irvine, CA). The RNA samples were depleted of the 16S- and 23S-rRNA through hybridization to complementary biotinylated oligonucleotides and subsequent removal with streptavidin-magnetic beads (modified from [55 (link)]). Construction of cDNA libraries and high throughput sequencing of RNA was carried out by the Roy J. Carver Biotechnology Center at University of Illinois at Urbana Champaign. All measurements were done in triplicate. The Rockhopper [56 (link)] bacterial RNA-seq analysis software was used to map RNA reads to the M. acetivorans genome using the default parameters with verbose output enabled. Reads per kilobase per million reads (RPKM) values from the three replicates were averaged and used in subsequent analysis.

Cells were lysed in TRIzole (Invitrogen) and then performed the RNA isolation following the standard protocol. An optimized amount of RNA was used for Reverse transcription using ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Japan). Real-time PCR was performed on the CFX96 TouchTM Real-Time PCR Detection System (BIO-RAD) with SYBR Green Real time PCR Master Mix (TOYOBO, Japan). 2-Ct method was adopted to quantify the results. Statistical significance was determined using student t-test. The primer pairs used for real-time PCR were listed below.
Set7_Mus_RT_F: CACTCCTTCACTCCGAACTG
Set7_Mus_RT_R: TTCAGCTCCACTTGATACCAC
Gli3_Mus_RT_F: AGAAGCCCATGACATCTCAG
Gli3_Mus_RT_R: GGTCTGCTACACTACCTCCA
Gli1_Mus_RT_F: CTGAGACGCCATGTTCAATCC
Gli1_Mus_RT_R ACCAGAAAGTCCTTCTGTTCCC
Ptch1_Mus_RT_F: ACTACCCGAATATCCAGCACC
Ptch1_Mus_RT_R: ATCCTGAAGTCCTTGAAGCCA
GAPDH_Mus_RT_F: GAGAAACCTGCCAAGTATGATGAC
GAPDH_Mus_RT_R: TGGAAGAGTGGGAGTTGCTG
Set7_homo_RT_F: CATTTCTACCAATGCTCTTCTTCC
Set7_homo_RT_R: ACATAACAGTATTAGGTCCCACAG
Gli1_homo_RT_F: GGGATGATCCCACATCCTCAGTC
Gli1_homo_RT_R: CTGGAGCAGCCCCCCCAGT
Ptch1_homo_RT_F: CCACAGAAGCGCTCCTACA
Ptch1_homo_RT_R: CTGTAATTTCGCCCCTTCC
GAPDH_homo_RT_F: GAGTCAACGGATTTGGTCGT
GAPDH_homo_RT_R: GACAAGCTTCCCGTTCTCAG

Total RNA was isolated from different groups of CSC that had been transfected with either a plasmid or siRNA using Trizole (Invitrogen); RNA was reverse transcribed into cDNA using Revert Aid TM first cDNA synthesis kit (Fermentas), according to manufacturer's instruction. The relative levels of vimentin, E-cadherin, N-cadherin, Snail, Slug, and CK-18 mRNA transcripts to the control GAPDH were determined by quantitative real-time PCR using SYBR Green PCR Master Mix and specific primers on Applied Biosystems 7500 Fast Real-Time PCR System. Primer sequences are shown in Table 1. Amplification was performed at 95°C for 5 min, followed by 40 cycles of 94°C for 15s, 55°C for 20s, and 72°C for 20s, followed by extension at 72°C for 7 min. The relative levels of mRNA transcripts were analyzed by 2^−ΔΔCt.

The intestines from three tadpoles were pooled together for RNA isolation with Trizole (Invitrogen). Reverse transcription (RT) was carried out by using a reverse transcription kit (Applied Biosystem). Quantitative RT-PCR were carried out by using the SYBR green method with the forward primer 5′- CTTCTCCGTGTGGAGGATGG -3′ and reverse primer 5′- GGGGATCCAGCTCCAGTTTC -3′ for Twist1 (NM_001085883), forward primer 5′- GCTACACAGCAACCAGATTCCTC -3′ and reverse primer 5′- CGCTAAAGATGCACATCAGGACAC -3′ for Snai2 (NM_001086282), forward primer 5′- AGCCCAGTAAGGATGTGGTG -3′ and reverse primer 5′- GCTGCTGAGGTTGAACACAA -3′ for BMP4 (NM_001088032). The expression of the genes was normalized against the expression of EF1α (elongation factor 1α) (NM_001087442), which was analyzed as a control by using forward primer 5′- AAGAAGGATCTGGCAGCGG-3′ and reverse primer 5′- TTTAATGACACCAGTTTCCACA-3′.

Total RNA from the renal cortex tissue was extracted following the TRIzole method (Invitrogen, Carlsbad, CA). Subsequently, the quantity and integrity of the RNA was measured using the NanoDrop 8,000 (Thermo Scientific) and the Agilent Bioanalyzer 2,100 (Agilent Technologies), respectively. Refer to the Affymetrix manual for cRNA related experiments (Campus IFOM IEO, Italy). Samples were hybridized onto a Human Clariom D gene chip (Affymetrix, Santa Clara, California). The R statistical software pre-processed imported raw CEL files, and the Robust Multichip Average algorithm under the oligo package was used to normalize the data. The raw data were investigated using the transcriptome analysis console software (Applied Biosystems, Foster City, USA). A significant (p-value < 0.05) absolute fold change in gene expression of ≥ 1.5 indicated differentially expressed genes (DEGs). The R software (heatmap V1.0.12 and ggplot2 V3.3.6) was used to generate heatmaps and volcano plots of significant DEGs (Tian et al., 2021 (link)).