Total rna kit

Total RNA was isolated from Gc and Tc with the Total RNA kit (A&A Biotechnology, Gdynia, Poland), following the manufacturer’s recommendations, and quantified spectrophotometrically. The integrity of the product was confirmed on 1.5% agarose gel. Reverse transcription (RT) was performed using an Enhanced Avian HS RT-PCR Kit (Sigma Aldrich, St. Louis, MO, USA), and a mix of deoxynucleotides (dNTPs), and random hexamers as primers. The RT product was kept frozen at −20 °C for PCR analysis. Quantitative Real-Time PCR was used to establish dynamic changes in AQP5 mRNA expression. The following primer sequences were used [28 (link),32 (link)]: AQP5 forward CTATGAGTCCGAGGAGGATT, AQP5 reverse GCTTCGCTGTCATCTGTT (NM_001110424.1), GAPDH forward GACCTCCACTACATGGTCTA, GAPDH reverse AAGATGGTGATGGCCTTTC (access No.: NM_001206359.1), PPIA forward GCACTGGTGGCAAGTCCAT, and PPIA reverse AGGACCCGTATGCTTCAGGA (access No.: AY266299), available in GeneBank. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and Cyclophylin A (PPIA) were used as normalization controls. Real-Time PCR was performed (7300 Real-Time PCR system; Applied Biosystems, Foster City, CA, USA) as described previously [32 (link)]. Each experiment was independently repeated at least three times and the fold change in the expression of each gene was analyzed via the 2^−∆∆Ct method.

The THP-1 human monocyte cell line was purchased from the American Type Culture Collection. Cells were maintained in culture medium (RPMI 1640 supplemented with 10% fetal bovine serum, 2 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin) at 37°C in a humidified atmosphere of 5% CO₂. The cells were seeded into six-well plates at a concentration of 1 × 10⁶/ml in a whole volume of 4.8 ml/well. The cells were differentiated into macrophages by the addition of 100 ng/ml phorbol 12-myristate 13-acetate (PMA) for 72 h. After differentiation, the cells were washed twice with fresh media w/o PMA and stimulated with ES or whole parasite. For whole parasite stimulation, the cells were maintained in Nunc polystyrene (PS) EasYFlask™ 25 cm² (Thermo Scientific) flasks at the same cell concentration and density per square centimeter. In the case of cells stimulated with parasite antigens and LPS, the cells were first treated with LPS (100 ng/ml), and parasite (one 10-cm worm/10 × 10⁶ cells) or antigens (5 µg/ml) were added after 1 h. After 24 h, the stimulation culture media was collected and cells were washed with sterile PBS. Cells for phosphokinase analysis were lysed with lysis buffer from Proteome Profiler kit (R&D), cells for RNA isolation were directly treated with fenozol supplied with Total RNA kit (A&A Biotechnology) and stored at −80°C until use.

Purified bovine serum albumin (BSA), T6P dipotassium salt, uridine 5′-diphosphoglucose disodium salt from Saccharomyces cerevisiae (UDPG), d-glucose-6-phosphate disodium salt hydrate (G6P), and alkaline phosphatase from bovine intestinal mucosa (lyophilized powder, 10–30 defined enzyme activity (DEA) units/mL solid), penicillin G sodium salt, nystatin, IVM, 4-(2-hydroxyethyl)-piperazine-1-ethanesulfonic acid (HEPES), agarose, and ethidium bromide were purchased from Sigma-Aldrich (Germany and USA). Total RNA Kit, TranScriba Kit, and SYBR Green B PCR-MIX Taq were obtained from A&A Biotechnology (Poland). The components of 0.1 M acetic acid-ammonia buffer and 0.1 M phosphoric buffer (resp., pH 4.2 and pH 7.0) (acetic acid, ammonia, NaH₂PO₄, and Na₂HPO₄  × 7H₂O₂) and of Ascaris Ringer's Solution (ARS) medium (KCl, CaCl₂  × 2H₂O, MgCl₂  × 6H₂O, NaCl, and sodium acetate) were of high purity grade and were purchased from Chempur (Poland) and P.P.H. Stanlab (Poland).
The water used for the analysis was deionized with the use of a Direct-Q Ultrapure UV3 Water System (EMD Millipore, USA). The water, media, sodium saline, and surgical instruments were sterilized using a Classic Standard Prestige Medical autoclave (Ma-Je-R, Poland).