Pegfp n3 plasmid

The CRISPR-Cas9 and green fluorescent protein (GFP) fusion protein expression vector U6gRNA-Cas9+2A-GFP guide by ABCB1 sgRNA (abbreviated as ABCB1-Cas9-GFP) was purchased from Horizon Discovery (DNA 2.0 Inc., CA, USA). GFP was co-expressed from the same mRNA as the Cas9 protein via a 2A peptide linkage, which enabled tracking of transfection efficiency. The exon of ABCB1 selected for sgRNA design is located on the fifth coding exon (Figure 3A). The ABCB1 sgRNA sequence is as follows: 5′-CCAAACACCAGCATCATGAG-3′ (Figure 3B). The pEGFP-N3 plasmid was purchased from Clontech Laboratories, Inc. (Mountain View, CA, USA). Plasmids were purified using QIAGEN Plasmid Mega Kits (Hilden, Germany) according to the Plasmid Purification Handbook. To determine the yield of each plasmid, DNA concentrations were determined by both UV spectrophotometry at 260 nm and quantitative analysis on an agarose gel.

To meet the objectives of this study, pUC57-PT (BIOMATIK, Canada) was subject to a few cloning steps. 918 bp long fragment digested by HindIII – BamHI (Roche, Germany) enzymatic reaction was directly cloned into pEGFP-N3 plasmid (Clontech, USA) digested with the same enzymes. Polytope sequence was inserted in-frame upstream to the EGFP sequence generating pEGFP-PT. The polytope sequence in tandem with EGFP was digested out of the pEGFP-PT by Bgl II – Not I restriction enzymes (Roche, Germany) and sub-cloned into pLEXSY-neo-2 plasmid (Jena Biosciences, Germany) making pLEXSY-PT-EGFP. Eventually polytope sequence was amplified with a set of primers (forward: CGCAAGCTTACCATGCAGATTTTCG and Reverse: AATGGATCCCTACACCAGCAGCACGCC, MWG, Germany) with HindIII and BamHI restriction sites (underlined) and stop codon on reverse primer (bold). The PCR product was directly cloned into pcDNA3.1(+) vector (Invitrogen, USA) which was digested with HindIII and BamHI. Recombinant pcDNA-PT was next subject to sequencing.

Full-length dmsuv3 cDNA was obtained from the Drosophila Genomics Resource Center (LD23445). A single G deletion in the cDNA in position 849 was corrected by site-directed mutagenesis, using Phusion High Fidelity DNA Polymerase (Finnzymes). The cDNA was PCR amplified and cloned in the pEGFP-N3 plasmid (Clontech) to generate a dmsuv3-GFP fusion construct. The dmsuv3-GFP fusion construct was subsequently cloned in pAc5.1/V5-His A plasmid (Life Technologies) for expression in Schneider 2R+ cells. Primers used for the cloning of DmSUV3 are listed in Supplementary Table S1.

The human cxcr5 promoter (−455/+368) and enhancer element (+2991/+5107) were amplified by PCR using genomic DNA from MCF-7 cells as a template and specific primers (see Supplementary Table 1) containing cloning sites. CXCR5 promoter variants containing deletions and mutations in the predicted NFκB sites were generated by two-step PCR mutagenesis and verified by sequencing. All variants of CXCR5 promoter were digested with HindIII and NcoI, cloned into pGL3-basic luciferase reporter construct (Promega, Madison, USA), and sequenced. Predicted cxcr5 gene enhancer element was cloned downstream of the luciferase gene using BamHI and SalI restriction sites.
NFκB response element consisting of 5 tandem NFκB consensus sites: GAG CTC GGG AAC TTC CGG GAA TTT CCG GGG AAG TCC GGG AAA TTC CGG GAC TTC CCC CCG GG, and minimal CMV promoter47 amplified from pEGFP-N3 plasmid (Clontech Laboratories, Madison, USA) with primers represented in Supplementary Table 1, were cloned into pGL3-basic luciferase reporter vector (Promega, Madison, USA) using restriction sites XhoI/HindIII and HindIII/NcoI respectively. Hyperactivation or inhibition of NFκB in MCF-7 cells was achieved using co-transfection of plasmid vectors expressing p65/RelA or dominant negative IκBα mutant48 (link).

The African green monkey kidney-derived cell line, COS-7, was obtained from the American Type Culture Collection (CRL-1651) and cultured in Dulbecco’s modified Eagle’s medium (GIBCO) supplemented with 10% fetal calf serum and antibiotics (100 IU/mL penicillin and 100 µg/mL streptomycin) at 5% CO₂ and 95% air, maintained at 37 °C in a humidified incubator. Cells were transfected in 35-mm Petri dishes when the culture reached 50–60% confluence, with DNA (2 µg total DNA) complexed with jetPEI (Polyplus transfection) according to the standard protocol recommended by the manufacturer. COS-7 cells were co-transfected with 200 ng of pCI-SCN5A (NM_000335.4), 200 ng of pRC-SCN1B (NM_001037) (kind gifts of AL George, Northwestern University, Feinberg School of Medicine) and 1.6 µg pEGFP-N3 plasmid (Clontech). Cells were re-plated onto 35-mm Petri dishes the day after transfection for patch-clamp experiments. HEK293 cells stably expressing hNa_v1.5 were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal calf serum, 1 mM pyruvic acid, 2 mM glutamine, 400 µg/ml of G418 (Sigma), 100 U/mL penicillin and 100 μg/mL streptomycin (Gibco, Grand Island, NY) at 5% CO₂ and 95% air, maintained at 37 °C in a humidified incubator.