Rneasy procedure

Manufactured by Qiagen

Sourced in Germany

The RNeasy procedure is a laboratory equipment product designed for the isolation and purification of RNA from various biological samples. It provides a reliable and efficient method for extracting high-quality RNA.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

RNeasy purification procedure (7 citations) RNeasy Mini Procedure (4 citations) RNeasy mini kit RNA cleanup procedure (3 citations) RNeasy Micro clean-up procedure (2 citations) RNeasy minikit procedure (2 citations) RNeasy column clean up procedure (2 citations)

3 protocols using rneasy procedure

Quantitative Analysis of Myelination Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA purification was done using the RNeasy procedure (Qiagen, Hilden, Germany). RNA was reverse transcribed using the high-capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Quantitative determination of gene expression levels was performed on StepOne detection system (Applied Biosystems) using SybrGreen Universal Master Mix (Applied Biosystems). To determine the transcript levels of CNPase, MBP, myelin oligodendrocyte glycoprotein, p57kip2, Hes1, Rock2, Id2, and Id4 genes, previously described sequences were used (Torres et al., 2012 (link)). Additional primers for the detection of Hes5 transcript levels were generated: GGTTCCAGAGGCCAAACATC, GTTGCCACATTGACCGTGAC. Glyceraldehyde-3-phosphate dehydrogenase was used as reference gene, and relative gene expression levels were determined according to the ΔΔCt method (Applied Biosystems). Triplicates of independent experiments were performed with duplicated wells per condition. Each sample was quantitated by duplicate. Results are shown with data from the triplicates in the Figures (mean values ± Tukey’s range). Prism5 GraphPad Software was used for statistical analysis. Two-way analysis of variance test was done to determine statistical significance in time-course experiments and post hoc multiple t tests were done to determine difference between controls and treatment at a specific time point.

Muñoz-Esquivel J., Göttle P., Aguirre-Cruz L., Flores-Rivera J., Corona T., Reyes-Terán G., Küry P, & Torres K.J. (2019). Sildenafil Inhibits Myelin Expression and Myelination of Oligodendroglial Precursor Cells. ASN NEURO, 11, 1759091419832444.

+ Open protocol

+ Expand

Quantification of Mouse Brain mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from mouse brain tissue using the Qiagen RNeasy procedure (Qiagen, Valencia, CA), and recovered RNA concentrations were measured using a NanoDrop ® ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE). RNA was converted to cDNA with a GeneAmp RNA PCR kit (Applied Biosystems, Foster City, CA). Target mRNA was quantified by quantitative-PCR (qPCR) and normalized relative to ribosomal 18S (r18S) mRNA. The qPCR analysis was performed in a 96-well format on an ABI Prism 7900HT Sequence Detection System (Applied Biosystems). For amplification of target genes, predesigned primers and probes from Applied Biosystems were used: interleukin-1β (IL-1β) (Mm00434228_m1), tumor necrosis factor-α (TNF-α) (Mm00443260_g1), interleukin-6 (IL-6) (Mm00446190_m1), and r18S (Mm02601777_g1). Relative quantification of gene expression was analyzed as a treatment-to-control expression ratio using the comparative ΔΔCt method. Each sample was analyzed in triplicate on two separate occasions.

Hultman K., Cortes-Canteli M., Bounoutas A., Richards A.T., Strickland S, & Norris E.H. (2014). Plasmin Deficiency Leads to Fibrin Accumulation and a Compromised Inflammatory Response in the Mouse Brain. Journal of thrombosis and haemostasis : JTH, 12(5), 701-712.

+ Open protocol

+ Expand

Quantification of B. cenocepacia Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

B. cenocepacia cultures (OD₆₀₀ 0.4–0.8) were incubated with RNAprotect^® (Qiagen), centrifuged and lysed with lysozyme (1 mg/ml) in 10 mM Tris-HCl, 1 mM EDTA (pH7.5) for 10 min. RNA was isolated by RNeasy procedure (Qiagen) and DNase treated with turbo DNA-free kit^™ (Ambion) and converted to cDNA using Superscript^® VILO™ cDNA synthesis kit (Invitrogen). Primers (Bio-sciences) were designed using NCBI primer design tool (Supplementary Information Table S7). QPCR was performed using Power SYBR^® green master mix in 25 µl containing 250 ng cDNA, 300 nM forward and reverse primers. No-template controls were included on each plate and amplification performed on Applied Biosystems 7300 real-time PCR system: initial step 95 °C, 10 min; 40 cycles of 95 °C, 5 sec and 60 °C for 1 min^{69 (link)}. Relative quantification (RQ) expression differences were determined using the 2^−ΔΔCt method.

Cullen L., O’Connor A., McCormack S., Owens R.A., Holt G.S., Collins C., Callaghan M., Doyle S., Smith D., Schaffer K., Fitzpatrick D.A, & McClean S. (2018). The involvement of the low-oxygen-activated locus of Burkholderia cenocepacia in adaptation during cystic fibrosis infection. Scientific Reports, 8, 13386.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!