Mia paca 2

The cholangiocarcinoma cell lines HuCCT-1 and HuH28 were purchased from the Japanese Collection of Research Bioresources (Osaka, Japan); and the RBE, SSP25 and YSCCC cell lines from the RIKEN Bioresource Center (Ibaraki, Japan). RBE, HuCCT-1, HuH28, SSP25 and YSCCC cell lines were cultured in RPMI-1640 (Invitrogen, Tokyo, Japan) containing 10% FBS, and the OZ cell line was cultured in Williams' E medium (Invitrogen) containing 10% FBS. The pancreatic cancer cell lines, such as Panc1, PK-8, PK-59, KLM-1 and MiaPaCa-2, were purchased from the RIKEN Bioresource Center (Ibaraki, Japan), and the Hs700T cell line from the American Type culture collection (Manassas, VA, USA). Panc1, PK-8, PK-59 and KLM-1 cell lines were cultured in RPMI-1640 containing 10% FBS, and the MiaPaCa-2 and Hs700T cells were cultured in D-MEM (Invitrogen) containing 10% FBS. All cultures were maintained in a 5% CO₂ air-humidified atmosphere at 37°C.

MCF10A cells were purchased from ATCC, and Human Mammary Epithelial Cells (HMEC) were purchased from Thermo Fisher Scientific (A10565). These cells were cultured in mammary epithelium basal medium (MEBM, #CC‐4136, Lonza) supplemented with bovine pituitary extract (#CC‐4009G, Lonza), 20 ng/mL hEGF (#CC‐4017G, Lonza), 10 μg/mL insulin (#CC‐4021G, Lonza), 0.5 mg/mL hydrocortisone (#CC‐4031G, Lonza), and 100 ng/mL cholera toxin solution (#030–20621, Wako). HEK293T (#RCB2002) and MIA‐PACA‐2 (#RCB2094) were purchased from RIKEN BRC. p53‐deficient mouse ovary surface epithelium (MOSE) cells (#JCRB0151.1) were purchased from JCRB cell bank and cultured in Dulbecco's modified Eagle's medium (#04129775, Wako) supplemented with 10% fetal bovine serum (FBS, #10270‐106, Thermo Fisher Scientific) and 1% penicillin–streptomycin solution (#16823291, Wako). All cells were maintained in a humidified CO₂ incubator at 37°C. Mycoplasma infection was regularly checked by PCR using the following sequences of the primers: forward: ACACCATGGGAGCTGGTAAT, reverse: CTTCWATCGACTTYCAGACCCAAGGC.