Q 6000 machine

Total RNA was extracted from fresh whole blood utilizing TriPure isolation reagent (Roche, Germany). cDNA was synthesized using RT-ROSET Kit (ROJETechnologies, Iran) and SYBR Green-based (TaKaRa, Otsu, Japan) and subsequently, RT-qPCR was performed, according to the manufacturers’ instructions. The following primers were utilized to determine the expression levels of JNK, EVI1, MKP, and PTPRR and to confirm HTLV-1 infected cells in the samples: EVI1 (forward primer (FP): 5′-TCGTCGCCTCATTCTGAACTGGAA-3′, reverse primer (RP): 5′-ACTGCCATTCATTCTCTCCTCCACA-3′) MKP (FP: 5′-AGCCACCATCTGCCTTGCT-3′ , RP: 5′-CCAGCCTCTGCCGAACAGT-3′ ) PTPPR (FP: 5′-CCAGCACTGTCCGAGGCAA-3′ , RP: 5′-GCAAACAGAGGTAGCGGTGGT-3′ ) JNK (FP: 5′-TGCTGTGTGGAATCAAGCACCT-3′ , RP: 5′-TCGGGTGCTCTGTAGTAGCGA-3′ ) HBZ (FP: 5′-ACGTCGCCCGGAGAAAACA-3′ , RP: 5′-CTCCACCTCGCCTTCCAACT-3′) 5’LTR (FP: 5′-GGCTCGCATCTCCCCTTCAC-3′ , RP: GAGCAAGCAGGGTCAGGCAA-3′). The relative two standard curves real-time PCR was performed on the cDNA samples using Q-6000 machine (Qiagen, Germany). The GAPDH gene was utilized to normalize the mRNA expression levels respectively, as well as to control the error between samples [32 (link)]. The output for each group was analyzed using Mann-Whitney U test for statistical difference between gene expression. A p-value of less than 0.05 was considered to be significant.

Total RNA was extracted from fresh PBMCs using TriPure isolation reagent (Roche, Germany) according to the manufacturer’s instructions. Double-stranded cDNA was synthesized using the RevertAid TM first-strand cDNA synthesis kit (Fermentas, Germany). Following primers and probes were designed and used to determine the expression levels of STAT1, PSMB8, TAP1 : STAT1 (forward primer: 5ʹ-AACATGGAGGAGTCCACCAATG-3ʹ, reverse primer: 5ʹ-GATCACCACAACGGGCAGAG-3ʹ and TaqMan probe: FAM- TCTGGCGGCTGAATTTCGGCACCT -BHQ1), PSMB8 (forward primer: 5ʹ-GTTCAGATTGAGATGGCCCATG-3ʹ, reverse primer: 5ʹ-CGTTCTCCATTTCGCAGATAGTAC-3ʹ and TaqMan probe: FAM- CCACCACGCTCGCCTTCAAGTTCC -BHQ1), TAP1 (forward primer: 5ʹ-TACCGCCTTCGTTGTCAGTTATG-3ʹ, reverse primer: 5ʹ-GAGCCCAGGCAGCCTAGAAG-3ʹ and TaqMan probe: Fam-CGCACAGGGTTTCCAGAGCCGCC-BHQ1). The primers and probes of Tax and HBZ were synthesized according to published data [33 (link)]. The relative 2 standard curves real-time PCR was carried out on the cDNA samples using TaqMan master mix (Takara, Otsu, Japan) and a Q-6000 machine (Qiagen, Germany). The GAPDH gene was employed as a housekeeping gene to normalize the mRNA expression levels, and also to control the error between samples [32 (link), 34 (link)].

QPCR was used for gene expression analysis. The relative expression of RIPK1 and RIPK3 genes compared to the beta-2 microglobulin (β2M) reference gene was performed by using the Eva green Master mix kit (Qiagen, Germany). The Primers used in this study were designed with Beacon Designer (PREMIER Biosoft, USA) and checked with Nucleotide and PCR Blast (NIH.NLM. Blast, USA), and they were sent for synthesis (Table 1). The validity of the primers was confirmed with conventional PCR.Table 1

Sequence of primers.

Table 1

Target gene	Sequence (5'→3′)	length	Product size	RefSeq
RIPK1	F: 5′-GGGAAGGTGTCTCTGTGTTTC-3′	21	91 bp	NM_001354930.2
	R: 5′-CCTCGTTGTGCTCAATGCAG-3′	20
RIPK3	F: 5′-ATGTCGTGCGTCAAGTTATGG-3′	21	136 bp	NM_006871.4
	R: 5′-CGTAGCCCCACTTCCTATGTTG-3′	21
Beta2 microglobulin	F: 5′-TTGTCTTTCAGCAAGGACTGG-3′	21	127 bp	NM_004048.4
	R: 5′-CCACTTAACTATCTTGGGCTGTG-3′	23

Quantities RT-PCR was performed on the cDNA samples using relative two standard curves methods as previously, described.²¹ A Q 6000 Machine (Qiagen, Germany) was used for qRT-PCR and the results were analyzed by Rotor Gene 6000 software. The concentration of each primer for PCR reaction was between 0.5 μM and 1 μM.