Log In Sign up
The largest database of trusted experimental protocols

The SSIII is a laboratory instrument designed for the purification and analysis of nucleic acids. It provides automated sample handling and processing capabilities to facilitate efficient nucleic acid extraction and purification workflows.

Automatically generated - may contain errors

Lab products found in correlation

Primestar gxl, by Takara Bio (4 mentions) Trizol ls, by Thermo Fisher Scientific (4 mentions) Trizol, by Thermo Fisher Scientific (3 mentions) Biolane hti 16 vx platform, by Intavis (2 mentions) Dntps, by Thermo Fisher Scientific (2 mentions) Rnase r, by Illumina (2 mentions) Sybr green master mix, by Roche (2 mentions) Itaq universal sybr green supermix, by Bio-Rad (2 mentions) Sybr green, by Thermo Fisher Scientific (1 mentions) Rnaseout, by Thermo Fisher Scientific (1 mentions) Platinum taq polymerase, by Thermo Fisher Scientific (1 mentions) Dithiothreitol (dtt), by Thermo Fisher Scientific (1 mentions) Sybr green, by Merck Group (1 mentions) Rneasy micro kit, by Qiagen (1 mentions) Pjet1.2 blunt, by Thermo Fisher Scientific (1 mentions) Steponeplus rt qpcr system, by Thermo Fisher Scientific (1 mentions) Sybr green master mix, by Thermo Fisher Scientific (1 mentions) Fastap thermosensitive alkaline phosphatase, by Thermo Fisher Scientific (1 mentions) T4 ligase, by New England Biolabs (1 mentions) Dynabeads mrna direct purification kit, by Thermo Fisher Scientific (1 mentions)

17 protocols using ssiii

1

RNA Extraction and cDNA Synthesis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
For RNA extraction, cells were resuspended in TRIzol LS (Thermo Fisher, 10296010) and extracted using chloroform. The aqueous phase was then precipitated in isopropanol, pelleted, and resuspended in H2O. For cDNA synthesis 0.5 µg total RNA was mixed with 0.5 µg of random hexamer primers (N6) and denatured at 72 °C for 5 min. Subsequently, a reaction mixture containing 1x SSIII RT buffer, 1 mM dNTPs, 5 mM DTT, and 0.5 µl SSIII (Invitrogen, 18080093) was added to reach a total volume of 20 µl. The RT reaction was performed at 55 °C for 1 h and inactivated for 10 min at 70 °C. The qPCR was performed in a final concentration of 1x iTaq Universal SYBR Green Supermix (Biorad, 1725121), 0.4 µM primer each, and 1 µl of the cDNA in a total volume of 10 µl.
Weber R., Ghoshdastider U., Spies D., Duré C., Valdivia-Francia F., Forny M., Ormiston M., Renz P.F., Taborsky D., Yigit M., Bernasconi M., Yamahachi H, & Sendoel A. (2022). Monitoring the 5′UTR landscape reveals isoform switches to drive translational efficiencies in cancer. Oncogene, 42(9), 638-650.
+ Open protocol
+ Expand
2

Comprehensive RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For RNA extraction, cells were resuspended in TRIzol LS (Thermo Fisher, 10296010) and extracted using chloroform. The aqueous phase was then precipitated in isopropanol, pelleted, and resuspended in H2O. For cDNA synthesis 0.5 µg total RNA was mixed with 0.5 µg of random hexamer primers (N6) and denatured at 72 °C for 5 min. Subsequently, a reaction mixture containing 1x SSIII RT buffer, 1 mM dNTPs, 5 mM DTT, and 0.5 µl SSIII (Invitrogen, 18080093) was added to reach a total volume of 20 µl. The RT reaction was performed at 55°C for one hour and inactivated for 10 min at 70 °C. The qPCR was performed in a final concentration of 1x iTaq Universal SYBR Green Supermix (Biorad, 1725121), 0.4 µM primer each, and 1 µl of the cDNA in a total volume of 10 µl.
Weber R., Ghoshdastider U., Spies D., Duré C., Valdivia-Francia F., Forny M., Ormiston M.L., Renz P.F., Taborsky D., Yiğit M., Yamahachi H., & Sendoel A. (2021). Monitoring the 5’UTR landscape reveals 5’terminal oligopyrimidine (TOP) motif switches to drive translational efficiencies.
+ Open protocol
+ Expand
3

In Situ Hybridization Probe Templates for Zebrafish

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
All in situ hybridization probe templates were amplified using Primestar-GXL (Takara) from cDNA prepared with SSIII (ThermoFisher) with the following primers: ambn 5′-TGATGATCGTGTGCTTTCTTGCTG, 5′-aaaaTAATACGACTCACTATAGCATTTTGCCCCTGTTGTGGTCTTG; itga5 5′-AGGAAGGAAGTGTACATGGGTGA, 5′-aaaaTAATACGACTCACTATAGgatccagttttgtcccagatgac; itgb3b 5′-TGGACCTGTCCTACTCCATGAAT, 5′-aaaaTAATACGACTCACTATAGacactgtctttttagcgctgtcc; col10a1a 5′-gaacccaagtatgccgatttgacc, 5′-aaaaTAATACGACTCACTATAGtgttttgatgtgatgtggatgggt; col10a1b 5′-gcttagcttcagaaaATGGACCTCA, 5′-aaaaTAATACGACTCACTATAGTGGTTGTCCCTTTTCACCTGGATA; tcf7 5′-CCAACAAGGTGTCGGTGGT, 5′-aaaaTAATACGACTCACTATAGACCAGTCCGTCTGttggttcag; jag1a 5′-CCCTTGACCAAACAAATGACAA, 5′-aaaaTAATACGACTCACTATAGGCTGTGTTTTCTTCAGGTGTGG. chad 5′-AGACCAAACATCCAGACAGCAA, 5′-aaaaTAATACGACTCACTATAGGCAATTGCATCATCCTTCACAT. In situ hybridization probes and tissue were prepared as described previously (Quigley et al., 2004 (link)), with hybridization and post-hybridization washes performed on a BioLane HTI 16 Vx platform (Intavis Bioanalytical Instruments) and post-staining vibratome sectioning in some cases as described (Aman et al., 2018 (link)).
Aman A.J., Saunders L.M., Carr A.A., Srivatasan S., Eberhard C., Carrington B., Watkins-Chow D., Pavan W.J., Trapnell C, & Parichy D.M. (2023). Transcriptomic profiling of tissue environments critical for post-embryonic patterning and morphogenesis of zebrafish skin. eLife, 12, RP86670.
+ Open protocol
+ Expand
4

In Situ Hybridization Probe Templates for Zebrafish

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
All in situ hybridization probe templates were amplified using Primestar-GXL (Takara) from cDNA prepared with SSIII (ThermoFisher) with the following primers: ambn 5′-TGATGATCGTGTGCTTTCTTGCTG, 5′-aaaaTAATACGACTCACTATAGCATTTTGCCCCTGTTGTGGTCTTG; itga5 5′-AGGAAGGAAGTGTACATGGGTGA, 5′-aaaaTAATACGACTCACTATAGgatccagttttgtcccagatgac; itgb3b 5′-TGGACCTGTCCTACTCCATGAAT, 5′-aaaaTAATACGACTCACTATAGacactgtctttttagcgctgtcc; col10a1a 5′-gaacccaagtatgccgatttgacc, 5′-aaaaTAATACGACTCACTATAGtgttttgatgtgatgtggatgggt; col10a1b 5′-gcttagcttcagaaaATGGACCTCA, 5′-aaaaTAATACGACTCACTATAGTGGTTGTCCCTTTTCACCTGGATA; tcf7 5′-CCAACAAGGTGTCGGTGGT, 5′-aaaaTAATACGACTCACTATAGACCAGTCCGTCTGttggttcag; jag1a 5′-CCCTTGACCAAACAAATGACAA, 5′-aaaaTAATACGACTCACTATAGGCTGTGTTTTCTTCAGGTGTGG. chad 5′-AGACCAAACATCCAGACAGCAA, 5′-aaaaTAATACGACTCACTATAGGCAATTGCATCATCCTTCACAT. In situ hybridization probes and tissue were prepared as described previously (Quigley et al., 2004 (link)), with hybridization and post-hybridization washes performed on a BioLane HTI 16 Vx platform (Intavis Bioanalytical Instruments) and post-staining vibratome sectioning in some cases as described (Aman et al., 2018 (link)).
Aman A.J., Saunders L.M., Carr A.A., Srivatasan S., Eberhard C., Carrington B., Watkins-Chow D., Pavan W.J., Trapnell C, & Parichy D.M. (2023). Transcriptomic profiling of tissue environments critical for post-embryonic patterning and morphogenesis of zebrafish skin. eLife, 12, RP86670.
+ Open protocol
+ Expand
5

qRT-PCR Analysis of Differentiation Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from differentiation cultures with the RNeasy Micro Kit (QIAGEN) according to the manufacturer’s specifications. The extracted RNA was transcribed into cDNA using random hexamers, dinucleotide triphosphates (dNTPs), 5× first strand buffer, DTT, RNaseOUT, and SSIII (Thermo Scientific). The qRT-PCR analysis was carried out with SYBR green (Sigma) detection using Platinum Taq polymerase, SYBR green, and Rox reference dye, dNTPs (all from Thermo Scientific), and primers (Sigma) (for primer sequences, see Table S1) on an ABI 7900HT Fast Real Time PCR cycler (Thermo Scientific). Reaction efficiency was calculated for each primer pair with serial dilutions of cDNA template, and melting curve analysis was performed at the end of each reaction for detection of unspecific product amplification. Relative quantification of transcript levels were calculated using ΔCT values normalized to β-ACTIN, and the fold change of gene expression was calculated relative to day 0 of differentiation.
Rönn R.E., Guibentif C., Moraghebi R., Chaves P., Saxena S., Garcia B, & Woods N.B. (2015). Retinoic Acid Regulates Hematopoietic Development from Human Pluripotent Stem Cells. Stem Cell Reports, 4(2), 269-281.
+ Open protocol
+ Expand
6

Probe Design for In-Situ Hybridization

Check if the same lab product or an alternative is used in the 5 most similar protocols
All in-situ probe templates were amplified using Primestar-GXL (Takara) from cDNA prepared with SSIII (ThermoFisher) with the following primers: slc16a10 5’-tctgtctgatcatcacgctcct, 5’-tctgtctgatcatcacgctcct; slco1c1 5’-AACACACTCGTTTTGGACCACA-3’, 5’-GTTGCCTATTTCAAAGCTGCCG-3’; thraa 5’-TTTCGCGTTGTTTTGGAAGCAG, 5’-CAGCGGTAATGATAGCCAGTGG-3’; thrab 5’-CTCACATGATTGGCTGCTGGAT-3’, 5’-CAGCGGTAATGATAGCCAGTGG-3’; thrb 5’-AGCACGAGATATCAGCGAGTCT-3’, 5’-TTGAAGCGACATTCTTGGCACT-3’; rxrab 5’-GAAGATTCTGGAGGCCGAACTG-3’, 5’-CTCGTTCCCTTAATGCCTCCAC-3’; rxrba 5’-AGACCGCAGTGTATCATCAGGA-3’, 5’-TTCCTCACAGTGCGCTTGAAAA-3’; rxrbb 5’-TCGGCGTTTGTTGGAAGATAATCA-3’, 5’-GTCCCCACAAATTGCACACATG-3’; rxrga 5’-CTCTATGCCCACCACTTCCAAC-3’; 5’CCACCGGCATCTCTTCATTGAA-3’; rxrgb 5’-CTCTCAGTTCGCCCTCCATTTC-3’, 5’-TGTGTACGTCTCAGTCTTGGGT-3’. A T7 RNA polymerase binding site with short 5’-tail (aaaaTAATACGACTCACTATAG ) was added to reverse primers for transcription using T7 RNA polymerase incorporating DIG labelled ribonucleotides (NEB, Roche). PCR amplified probe templates were confirmed by sanger sequencing.
In-situ probes and tissue were prepared as described previously (Quigley et al., 2004 (link)). Hybridization and post-hybridization washes using a BioLane HTI 16Vx (Intavis Bioanalytical Instruments) were performed as previously described (Aman et al., 2018 ).
Aman A.J., Kim M., Saunders L.M, & Parichy D.M. (2021). Thyroid hormone regulates abrupt skin morphogenesis during zebrafish postembryonic development. Developmental biology, 477, 205-218.
+ Open protocol
+ Expand
7

Molecular Cloning and Transgenesis Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols
All coding sequences and in-situ probe templates were amplified using Primestar-GXL (Takara) from cDNA prepared with SSIII (ThermoFisher) and cloned into pJet1.2/blunt (ThermoFisher) with the following primers: lef1 5’tgtagggtgaggaggactttca, 5’cctgtagctgctgtctttgctt; axin2 5’agggataatattaagcgtcagcag, 5’ggcccttttgaagaagtatctgta; eda 5’agaggacgaggaagttcggtat; 5’gtgcatgtgttcaggtttggta; edar 5’ttacggcactaaagacgatgatta; 5’ggattagtgcagttctgtgttcc; fgfr1a 5’tcagaaagtgctgatgtcctagtc, 5’cataagtctgcacacacacacact, fgfr2 5’aattcgctgtctgctctttttct, 5’gtctcagtgtttttgagaactgga; shha 5’acaacgagaaaccctgctagac; 5’gtctctctctcactctcgctctct; hhip 5’tcagcagtcctgtttatttctgag, 5’gtaacattgccaaatggtgaagag. hsp70l:eda-2A-nls-mCherry abbreviated Eda-2A-mCherry, and hsp70l:edar-2A-nls-mCherry abbreviated Eda-2A-mCherry, were made using the tol2 Gateway Kit (Kwan et al., 2007 (link)), and injected together with tol2 mRNA (Kawakami, 2004 (link)).
Aman A.J., Fulbright A.N, & Parichy D.M. (2018). Wnt/β-catenin regulates an ancient signaling network during zebrafish scale development. eLife, 7, e37001.
+ Open protocol
+ Expand
8

Quantifying Circular RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse or rat brain DNase1-treated total RNA (1ug) was incubated 15 min at 37 °C with or without 3 U/μg of RNaseR (Epicentre Bio-technologies). RNA was subsequently purified by phenol-chloroform extraction. Reverse transcription (RT) was performed using random hexamers and reverse transcriptase (SSIII, Invitrogen). Quantitative PCR (qPCR) was done using SYBR green master mix (Roche). For circRNA transcripts, one primer was designed to anneal at the circular junction whereas the other was within the circRNA transcript. For linear transcripts, both primers were designed to amplify the sequence that is not part of any circRNA derived from the same gene locus. All qPCR primers are listed in Supplementary Table S3.
You X., Vlatkovic I., Babic A., Will T., Epstein I., Tushev G., Akbalik G., Wang M., Glock C., Quedenau C., Wang X., Hou J., Liu H., Sun W., Sambandan S., Chen T., Schuman E.M, & Chen W. (2015). Neural circular RNAs are derived from synaptic genes and regulated by development and plasticity. Nature neuroscience, 18(4), 603-610.
+ Open protocol
+ Expand
9

Quantifying Circular RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse or rat brain DNase1-treated total RNA (1ug) was incubated 15 min at 37 °C with or without 3 U/μg of RNaseR (Epicentre Bio-technologies). RNA was subsequently purified by phenol-chloroform extraction. Reverse transcription (RT) was performed using random hexamers and reverse transcriptase (SSIII, Invitrogen). Quantitative PCR (qPCR) was done using SYBR green master mix (Roche). For circRNA transcripts, one primer was designed to anneal at the circular junction whereas the other was within the circRNA transcript. For linear transcripts, both primers were designed to amplify the sequence that is not part of any circRNA derived from the same gene locus. All qPCR primers are listed in Supplementary Table S3.
You X., Vlatkovic I., Babic A., Will T., Epstein I., Tushev G., Akbalik G., Wang M., Glock C., Quedenau C., Wang X., Hou J., Liu H., Sun W., Sambandan S., Chen T., Schuman E.M, & Chen W. (2015). Neural circular RNAs are derived from synaptic genes and regulated by development and plasticity. Nature neuroscience, 18(4), 603-610.
+ Open protocol
+ Expand
10

Reverse Transcription and qPCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was synthesized by reverse transcription of 10 μg of total RNA using SSIII (Invitrogen) following the manufacturer’s protocol. Resulting cDNA was diluted 1:20 and used for gene expression analysis via qPCR. qPCRs were set up using SYBR green master mix (Applied Biosystems). qPCRs were run on the Applied Biosystems StepOnePlus RT-qPCR system using standard reaction parameters. Primers used for qPCR are listed in Table S2. All qPCR products were confirmed via sequencing. Samples with no template or with RNA that was not converted to cDNA did not yield products.
Junier A., Weeks A., Alcaraz Y, & Kumamoto C.A. (2022). Bypass of Dfi1 Regulation of Candida albicans Invasive Filamentation by Iron Limitation. mSphere, 7(1), e00779-21.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!