Briefly, 5 × 105 HFFs were seeded in T75 flask, cultured in growth medium without antibiotics for 24 h, and then transduced with lentiviral supernatant containing dCas9-VP64 (a gift from Feng Zhang, Addgene #61425) and MS2-P65-HSF1 (a gift from Feng Zhang, Addgene #61426) at a final concentration of 8 μg/mL polybrene. Twenty-four hours after transduction, lentiviral supernatant was replaced by selection medium. The working concentration of selection reagent was determined by a kill curve: 1 μg/mL blasticidin S HCL and 15 μg/mL hygromycin B. Medium was refreshed every 3 days and cells were passaged on day 7. HFFs without virus infection served as a negative control. pLenti CMV GFP Blast (a gift from Eric Campeau & Paul Kaufman, Addgene #17445) transduction control indicated transduction efficiency.
Ms2 p65 hsf1
Manufactured by Addgene
Sourced in United States
MS2-P65-HSF1 is a gene construct that expresses a fusion protein composed of the MS2 RNA-binding protein, the p65 activation domain, and the HSF1 DNA-binding domain. This construct is commonly used as a tool in research to activate target gene expression in a defined and controlled manner.
Automatically generated - may contain errors
Lab products found in correlation
Dcas9 vp64, by Addgene (7 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Plenti cmv gfp blast, by Addgene (1 mentions)
Pvsv g, by Addgene (1 mentions)
Pspax2, by Addgene (1 mentions)
Hifi dna assembly master mix, by New England Biolabs (1 mentions)
Pmscv ltr dcas9 vp64 bfp, by Addgene (1 mentions)
Lenti ms2 p65 hsf1 hygro, by Addgene (1 mentions)
Sgrna ms2, by Addgene (1 mentions)
Nextseq, by Illumina (1 mentions)
Lenti sgrna ms2 puro, by Addgene (1 mentions)
Sgrna, by Addgene (1 mentions)
Padv5 vector, by Thermo Fisher Scientific (1 mentions)
T7 ligase, by New England Biolabs (1 mentions)
Stbl3 competent cells, by Thermo Fisher Scientific (1 mentions)
11 protocols using ms2 p65 hsf1
1
Lentiviral Transduction of Human Fibroblasts
2
Stable Cell Lines with Overexpressed AhR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral infections were used to obtain stable cell lines. Lentiviral production was performed as recommended (http://tronolab.epfl.ch ) using HEK 293T cells, psPAX2 (Addgene, Cambridge, MA, USA #12260) and pVSV‐G (Addgene, #14888) plasmids, and the required vectors. Infections were performed overnight. To generate 501Mel cells individually overexpressing AhR, 501Mel cells were first transduced to stably express dCAS‐VP64 (Addgene, #61425) and MS2‐P65‐HSF1 (Addgene, #61426) before transduction with specific AhR sgRNAs (from Supplementary Table S of Gautron et al, 2021 (link)). Infected cells were selected using zeocin (600 μg/ml, 5 days). Lentivirus was manipulated in the biosafety level 3 containment laboratory core facility of the Biology and Health Federative Research Structure of Rennes (Biosit).
3
Activating Gene Expression with dCas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids carrying dCas9-VP64 and MS2-p65-HSF1 were purchased from Addgene (Watertown, MA, USA). pMSCV-LTR-dCas9-VP64-BFP was a gift from Stanley Qi and Jonathan Weissman (Addgene plasmid #46912). Lenti MS2-p65-HSF1_Hygro was a gift from Feng Zhang (Addgene plasmid #61426). The gRNA scaffold plasmid was synthesized based on previous efforts [16 (link)]. The genes of interest were isolated and integrated into the mammalian expression vector pcDNA3.1 by Gibson Assembly using HiFi DNA Assembly Master Mix from NewEngland BioLabs (Ipswich, MA, USA) per the manufacturer’s instructions. Bacteriophage MS2 (MS2), Bacteriophage Q-beta (Qb), Pseudomonas Phage PP7 (PP7), Enterobacteria Phage Lambda (Lambda), Satellite Tobacco Necrosis Virus (STNV), and Bovine Immunodeficiency Virus Trans-Activation Response (BIV-TAR) stem loop and aptamer DNA sequences were synthesized by IDT (Coralville, IA, USA) and assembled into a gRNA backbone in a pcDNA3.1 expression in a similar fashion.
4
Lentivirus Production and Cell Selection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The lentiviruses were produced in HEK-293FT cells using plasmids sgRNA (MS2) (#61427; Addgene, Cambridge, MA, USA), dCas9-VP64 (#61425; Addgene, Cambridge, MA, USA), or MS2-P65-HSF1 (#61426; Addgene, Cambridge, MA, USA). The sgRNA sramble (SCR) was constructed with the sequence GCACTACCAGAGCTAACTCA and the sgRNA T2 with the sequence ACATTACAAGTTGCAAATCA, according to protocol established by Konermann et al. (30 (link)).
Transduction and cell selection were performed serially: dCas9-VP64 was selected with blasticidin; MS2-P65-HSF1 was selected with hygromycin; and sgRNA-SCR or sgRNA-T2 was selected with zeocin. The concentration of antibiotics used was determined through a dose–response curve. The cells were plated to reach 50% of confluency 48 h before transduction and maintained for 24 h with a solution (1:1) of viral supernatant in culture medium, followed by of antibiotic selection until control cells died.
Transduction and cell selection were performed serially: dCas9-VP64 was selected with blasticidin; MS2-P65-HSF1 was selected with hygromycin; and sgRNA-SCR or sgRNA-T2 was selected with zeocin. The concentration of antibiotics used was determined through a dose–response curve. The cells were plated to reach 50% of confluency 48 h before transduction and maintained for 24 h with a solution (1:1) of viral supernatant in culture medium, followed by of antibiotic selection until control cells died.
5
Genome-Scale CRISPR Screen for Vemurafenib Resistance
6
RNA-seq of CRISPR-Cas9 edited HEK293FT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293FT cells were co-transfected with 10 ng gRNA targeting MIAT locus, 200 ng Cas9 constructs, 100 ng MS2-P65-HSF1 (Addgene plasmid ID: 61423), and 25 ng transfection control. Total RNA was extracted 72 h post transfection using RNeasy Plus mini kit (Qiagen) and sent to UCLA TCGB core on dry ice. Ribosomal RNA depletion, and single read library preparation were performed at UCLA core followed by RNA sequencing using NextSeq500. Coverage was 14 million reads per sample. FASTQ files with single-ended 75 bp reads were then aligned to the human GRCh38 reference genome sequence (Ensembl release 90) with STAR54 (link), and uniquely-mapped read counts (an average of 14.8 million reads per sample) were obtained with Cufflink55 (link). The read counts for each sample were then normalized for the library size to CPM (counts per million reads) with edgeR56 (link). Custom R scripts were then used to generate plots.
7
CRISPR-Cas9 Transfection and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293FT cells were co-transfected with 10 ng gRNA, 200 ng Cas9 constructs, 100 ng MS2-P65-HSF1 (Addgene plasmid ID: 61423) and 25 ng EBFP plasmid as the transfection control. Cells were lysed, and RNA was extracted using RNeasy Plus mini kit (Qiagen) 72 h post transfection, followed by cDNA synthesis using the High-Capacity RNA-to-cDNA Kit (Thermo Fisher). qRT-PCR was performed using SYBR Green PCR Master Mix (Thermo Fisher). All analyses were normalized to 18S rRNA (ΔCt) and fold changes were calculated against untransfected controls (2−ΔΔCt). Primer sequences for qPCR are listed in Supplementary Table 7 .
8
Endogenous Nrf1 Activation via CRISPR-dCAS9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used the CRISPR/dCAS9 gene editing system to activate endogenous Nrf1 expression according to the published protocol.
28 (link) Briefly, sgRNA targeting Nrf1 was cloned into Lenti‐sgRNA (MS2)_puro (Addgene, #73795). The dCas9‐VP64 (Addgene, #61425) and MS2‐P65‐HSF1 (Addgene, #61426) were introduced simultaneously into PSCs to activate endogenous Nrf1 expression. To construct NRF1 OE plasmid, Nrf1 cDNA was amplified from mouse PSCs and cloned into SalI and NheI sites of a modified pInducer20 (p20) vector (Addgene, #44012). The correctly inserted sgRNA sequence and Nrf1 cDNA in the expression vectors were confirmed by Sanger sequencing. The sequences of sgRNA for Nrf1 activation and primers for Nrf1 cDNA cloning are listed in TableS4 .
28 (link) Briefly, sgRNA targeting Nrf1 was cloned into Lenti‐sgRNA (MS2)_puro (Addgene, #73795). The dCas9‐VP64 (Addgene, #61425) and MS2‐P65‐HSF1 (Addgene, #61426) were introduced simultaneously into PSCs to activate endogenous Nrf1 expression. To construct NRF1 OE plasmid, Nrf1 cDNA was amplified from mouse PSCs and cloned into SalI and NheI sites of a modified pInducer20 (p20) vector (Addgene, #44012). The correctly inserted sgRNA sequence and Nrf1 cDNA in the expression vectors were confirmed by Sanger sequencing. The sequences of sgRNA for Nrf1 activation and primers for Nrf1 cDNA cloning are listed in Table
9
Activating Endogenous CDK13 using CRISPR-Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to activate endogenous CDK13 we used a CRISPR-Cas9 complex with three SAM components: dCas9–VP64 (Addgene #61425),MS2–p65–HSF1(Addgene, #61426), and sgRNA (Addgene, #89493) as described previously [31 (link)]. gRNAs were designed using the online optimized CRISPR design tool (http://crispr.mit.edu ) and targeted the proximal promoter regions of CDK13. Oligos, synthesized by Sangon Biotech., (Shanghai, China), were annealed and sub-cloned into the lentiGuide-puro vector.
10
CRISPR Activation Assay using SAM System
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR activation assay was conducted using the SAM system (http://sam.genome-engineering.org/protocols/). The sgRNA for hLMR1 was designed using the following sequence (Forward: CACCGGACAGACAGGAGAGCAGACT, Reverse: AAACAGTCTGCTCTCCTGTCTGTCC). Briefly, the template was ligated into the sgRNA (MS2) cloning backbone (Addgene: 61424) using Golden-Gate reaction (SAM) after Golden-Gate annealing. The expression cassettes of dCas9-VP64 (Addgene: 61422) and MS2-P65-HSF1
(Addgene: 61423) were sub-cloned into pAdv5 vector (Invitrogen) for virus packaging. SgRNA elements with the U6 promoter were amplified and subsequently cloned into pAd/PL adenovirus above. Three adenoviruses (1:1:1) were delivered into humanized mice intravenously at a total of 5 × 10 8 pfu/mouse. After seven days, tissue samples were harvested for further analysis.
(Addgene: 61423) were sub-cloned into pAdv5 vector (Invitrogen) for virus packaging. SgRNA elements with the U6 promoter were amplified and subsequently cloned into pAd/PL adenovirus above. Three adenoviruses (1:1:1) were delivered into humanized mice intravenously at a total of 5 × 10 8 pfu/mouse. After seven days, tissue samples were harvested for further analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!