Total RNA from tumours and cell lines was isolated with TRIzol reagent (Invitrogen) and converted into cDNA following the manufacturer’s instructions (Takara, Dalian, China). The PCR amplifications were performed with a StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, USA) using SYBR® Green Real-Time PCR (Takara, Dalian, China) with GAPDH as an internal control. For miRNA quantification, cDNA was synthesized from total RNA with a Mir-X miRNA First-Strand Synthesis Kit (Clontech Laboratories, Inc.) and quantified via qPCR using a Mir-X miRNA qRT-PCR SYBR Kit (Clontech Laboratories, Inc.) with U6 as an internal control. The relative RNA expression levels were calculated using the comparative Ct method. The following primers were used in the qRT-PCR experiments: miR-1275 (AB Assay ID 002840); U6 (AB Assay ID 001093); GADPH (AB Assay ID Hs00266705_g1); and JAZF1, sense, 5′-GGAGTCGGACAGCGATGATGAGT-3′, and antisense, 5′-GCTTCTCTTCCCCTCCATTCA-3′.
Sybr green real time pcr
Manufactured by Takara Bio
Sourced in Japan, United States, China
SYBR Green Real-Time PCR is a quantitative PCR technique that utilizes the SYBR Green dye to detect and quantify DNA sequences in real-time. The dye binds to double-stranded DNA, and the fluorescence emitted is proportional to the amount of DNA present in the sample. This method allows for the accurate measurement of gene expression levels or the quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Mir x mirna qrt pcr sybr kit, by Takara Bio (1 mentions)
Mir x mirna first strand synthesis kit, by Takara Bio (1 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500, by Takara Bio (1 mentions)
Primescript strand cdna synthesis kit, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Rna extraction kit, by BioTeke (1 mentions)
Reverse transcriptase, by Takara Bio (1 mentions)
Tri reagent, by Thermo Fisher Scientific (1 mentions)
Abi 7900ht instrument, by Thermo Fisher Scientific (1 mentions)
First strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Rneasy mini column, by Qiagen (1 mentions)
Lightcycler 480 system, by Roche (1 mentions)
Cfx connect real time pcr system, by Bio-Rad (1 mentions)
Hiscript 3 1st strand cdna synthesis kit, by Vazyme (1 mentions)
11 protocols using sybr green real time pcr
1
Quantification of miRNA and mRNA Levels
2
Quantifying Cellular lncRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells or tissues was extracted by TRIzol (Invitrogen, USA), and the quality of total RNA was detected at an A260/A280 ratio using quantification by NanoDrop (Thermo Scientific, USA). 1 μg of RNA was reverse-transcribed to cDNA using the PrimeScript Strand cDNA Synthesis Kit (Takara, Japan). qPCR analysis of lncRNA DRAIC, UCHL5 and NFRKB was performed on an Applied Biosystems ABI Prism 7500 sequence detection system, and RT products were quantified with SYBR Green real-time PCR (Takara, Japan). The expression of DRAIC, UCHL5 and NFRKB was normalized to that of β-Actin using the 2−ΔΔCt method. The sequences of β-Actin primers were: 5′-TGGCACCCAGCACAATGAA-3′ (forward); 5′-CTAAGTCATAGTCCGCCTAGAA-3′ (reverse). The sequences of DRAIC primers were: 5′-GTCTCAAACTCCCGACCTCA-3′ (forward); 5′-CAACCAGCTTGTGAGGCATT-3′ (reverse). The sequences of UCHL5 primers were: 5′-TTCGATGTCTCTAGGGTGGC-3′ (forward); 5′-GATCCACCTCTCGCTCTCAG-3′ (reverse). The sequences of NFRKB primers were: 5′-TGAAGACAGCTCAGATGCCA-3′ (forward); 5′-CTTGTCAAACACGCCCTTCA-3′ (reverse).
3
Quantitative Real-Time PCR for miR-22 and SP1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA extraction, the cells were lysed in Trizol reagent (Invitrogen, USA) and the SYBR Green Real-time PCR (Takara, China) assay was performed to detect mature miR-22 or SP1 mRNA expression. SYBR Green Real-time PCR was performed using the following primers: Calponin: sense, 5′-ACCAAGCGGCAGATCTTTGA-3′, antisense, 5′-CATCTGCAAGCTGACGTTGA-3′; α-SMA:sense, 5′-CTGCCTTGGTGTGTGACAATGG-3′, antisense, 5′-CGGGTACTTCAGGGTCAGGATTC-3′; SP1:sense, 5′-ACCTGGCGGTGATGGAAT-3′, antisense, 5′-GGTGGGTCTTGATATGCTTTG-3′; GAPDH:sense, 5′-GCACCGTCAAGGCTGAGAAC-3′, antisense, 5′-TGGTGAAGACGCCAGTGGA-3′; U6:sense, 5′-CTCGCTTCGGCAGCACA-3′, antisense, 5′-AACGCTTCACGAATTTGCGT-3′. U6 or GAPDH were used as endogenous controls. The 2–ΔΔCT method was used for data processing. miR-22 mimic and miR-22 inhibitor were synthesised by Guangzhou RiboBio, and the sequences are as follows: MiR-22mimics sense: AAGCUGCCAGUUGAAGAACUGU; mimics antisense: AGUUCUUCAACUGGCAGCUUUU; inhibitor: ACAGUUCUUCAACUGGCAGCUU. The mimic NC and inhibitor NC sequences are proprietary (Guangzhou RiboBio).
4
qRT-PCR Analysis of SDF-1α Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using an RNA Extraction Kit (Bioteke Co., Ltd, China), reverse transcription was carried out according to a PrimeScript RT Reagent Kit (Takara, Japan), and the target gene was detected via SYBR-Green real-time PCR (Takara, Japan). Samples were normalized to the expression level of β-actin. The primer sequences were as follows (see Table 1 ).Table 1
Primer sequence for the target genes.
| Gene name | Accession number | Sequence | PCR product |
|---|---|---|---|
| Human Stromal cell-derived factor-1 (hSDF-1α) | NM199168 | 5′-GCCGCACTTTCACTCTCC-3′ | 393 bp |
| Human β-actin | X00351.1 | 5′-GTGAAGGTGACAGCAGTCGGTT-3′ | 159 bp |
5
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After treatment, total cellular mRNA was isolated from PBMCs or MDMs using Tri Reagent (Thermo Fisher Scientific China, Shanghai, China). The isolated mRNA was then subjected to reverse transcription using reverse transcriptase (Takara, China). Real-time RT-PCR was performed to detect the mRNA expression of various genes with SYBR Green real-time PCR (Takara China, Dalian, China). The special oligonucleotide primers used in this study were synthesized by the Beijing Genomics Institute (Shenzhen, China), and the sequences are listed in Supplementary Table 1 .
6
NTN1 Expression in NSCL/P Patients
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Forty-six redundant lip tissue samples from NSCL/P patients who underwent surgery were collected. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The NTN1 mRNA levels relative to the transcription level of GAPDH were quantified by quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR) in an ABI 7900 HT instrument (Applied Biosystems, Foster City, CA, USA). All RT-qPCR reactions were performed using SYBR Green Real-Time PCR (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions. All reactions were performed in triplicate, and the relative gene expression was determined by the 2−ΔΔCt method [20 (link)]. The primers are listed in Supplementary Table S1 .
7
RT-PCR of FOXC1 Gene in A549 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from A549 cells was isolated and purified using TRIzol reagent (Invitrogen) and RNeasy mini columns (Qiagen, Valencia, CA), according to the manufacturer's instructions, respectively. cDNA was synthesized via reverse transcription, using the First-Strand Synthesis System (Invitrogen). RT-PCR was performed using SYBR Green Real-Time PCR (TaKaRa), following the manufacturer's instructions. The primer sequences used in this study are as follows: FOXC1 forward: 5′-CAGCATCCGCCACAACCTCT-3′; reverse: 5′-GCAGCCTGTCCTTCTCCTCCT-3′.
8
Quantification of Cardiac Metabolism Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sirt3, anf, β-mhc, lcad, cpt-1 and β-actin mRNA levels were quantified by SYBR Green Real-Time PCR (Takara) using a previously described protocol [28 (link)]. The genotyping for Sirt3-deficient mice was performed using the following primers: wild-type forward, 5′-CTT CTG CGG CTC TAT ACA CAG-3′; common, 5′-TGC AAC AAG GCT TTA TCT TCC-3′; mutant reverse, 5′-TAC TGA ATA TCA GTG GGA ACG-3′; ANF forward, 5′-TAA GCC CTT GTG GTG TGT CA-3′; and reverse, 5′-GCA AGA CCC CAC TAG ACC AC-3′; β-MHC forward, 5′-AAG GGC CTG AAT GAG GAG TA-3′; and reverse, 5′-AAA GGC TCC AGG TCT GAG G-3′; β-actin forward, 5′-CAA GAT CAT TGC TCC TCC TG-3′; and reverse, 5′-TCA TCG TAC TCC TGC TTG CT-3′; LCAD forward, 5′-AAG GAT TTA TTA AGG GCA AGA AGC-3′; and reverse, 5′-GGA AGC GGA GGC GGA GTC-3′; and CPT-1 forward, 5′-CGT CTT TTG GGA TCC ACG ATT-3′; and reverse, 5′-TTA AAC ATC CGC TCC CAC TGA GCG G-3′.
9
Circadian Rhythm Dysregulation in HIV
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HIV-1-positive patients who were not or were undergoing cART treatment and whose viral loads were <50 copies/mL as well as HIV-1-negative healthy individuals were enrolled in this study. Untreated HIV-1 patients were divided into two groups: LTNPs (CD4+ T-cell number remained >500 cells/μL after at least 8 years of infection) and RPs (CD4+ T-cell number < 350 cells/μL after 1-2 years of infection), as described previously [49 (link)]. Ethical approval for this study was obtained from the ethics review committee of the China Medical University, and written informed consent was obtained from all participants. PBMCs from these subjects were prepared by Ficoll–Hypaque density gradient centrifugation, and the cells were cryopreserved in fetal calf serum supplemented with 10% dimethyl sulfoxide and stored in liquid nitrogen within 8 h of collection. Total RNA extracted from thawed PBMCs (2-8 × 106) was reverse transcribed using oligodT as the primer. The mRNA levels of Per-1 and GAPDH were measured by SYBR Green real-time PCR (Takara) in the Light Cycler 480 System (Roche). The levels of Per-1 mRNA were normalized to those of GAPDH mRNA.
10
Quantifying Differential Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Parental SAM samples were collected at the initial developmental stage of the shoot bud. Total high-quality RNA was extracted using the FastPure Plant Kotal RNA Isolation Kit (Vazyme, Nanjing, China). Then, cDNA was synthesized using HiScript III 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Quantitative real-time PCR (qRT-PCR) was performed using SYBR Green Real-time PCR (Takara, Kusatsu, Japan) in a CFX Connect Real-time PCR system (BioRad, United States), and BnaActin was used as the reference gene. The 2-∆∆CT method was used to calculate the relative gene expression levels (Livak and Schmittgen, 2001 (link)). Each qRT-PCR experiment contained three technical replicates. The specific primers used for qRT-PCR are listed in Supplementary Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!