Pcdna3.1 mycbioid plasmid

To generate myc-BioID-DPR_x100 plasmids, sequences encoding poly-GR, -PR, and -GA (with alternating codons to avoid RNA repeats) were cloned into the pcDNA3.1 mycBioID plasmid (Addgene plasmid #35700) [80 (link)] by replacing the TDP-CTF BamHI/HindIII fragment in pcDNA3.1 mycBioID TDP-CTF [12 (link)]. Resulting plasmids encode myc-BioID-(GGGS)_x3-(DPR)_x100 fusion proteins. EGFP and mCherry-tagged DPR _x100 plasmids were generated by replacing the BioID NdeI/BamHI fragment in myc-BioID-(GGGS)_x3-(DPR)_x100 with EGFP or mCherry. 2xHA-poly-GA was cloned by replacing the PvuI/BamHI fragment of EGFP in EGFP-poly-GA with a double HA tag (MGYPYDVPDYAGGYPYDVPDYA). Expression constructs for EGFP-tagged SQSTM1, UBXN6, VCP, and HSPA8 (accession numbers #38277 [35 (link)], #86464 [75 (link)], # 23971 [55 (link)], #19487 [30 (link)], respectively), as well as mCherry-Calreticulin-N-16 (#55006) were obtained from Addgene. EGFP-tagged Calreticulin was cloned by replacing mCherry AgeI/NotI fragment in mCherry-Calreticulin-N-16 with EGFP from the pEGFP-N1 vector (Clontech).

All primers used in these cloning projects are listed in Table 1 (Supplementary Material). To generate amino-terminal 3XFLAG fusion constructs, PCR was used to introduce appropriate 5′ and 3′ restriction sites to furin, syntaxin 4, and Tgn38 cDNA (Origene, Rockville, MD). The PCR products were cloned in frame to the 3XFLAG coding sequence in the p3XFLAG-CMV 7.1 expression vector (Sigma Aldrich, St. Louis, MO). The GeneTailor Site-Directed Mutagenesis system (Life Technologies) was used to create 3XFLAG-syntaxin 4+YGRL, 3XFLAG-syntaxin 4 +YKGL, and 3XFLAG-syntaxin 4 +YQRL and 3XFLAG-TGN38 _YGRL, 3XFLAG-TGN38ΔYQRL, and 3XFLAG-furinΔYKGL constructs using previously described conditions (Moore et al., 2011 (link)). The 3XFLAG-furin_YGRL mutant was constructed by three-step site-specific PCR mutagenesis (Shokeen et al., 2008 (link)) using end, mutagenic and overlapping primers listed in Table 1. The overlap extension PCR cloning method (Bryksin and Matsumura, 2010 (link)) was used to create the 3XFLAG-syntaxin 6 and 3XFLAG-syntaxin 6 ΔYGRL (both constructs previously described in Moore et al., 2011 (link)) into the pcDNA3.1mycBioID plasmid (plasmid # 35700, Addgene.org) (Roux et al., 2012 (link)). All constructs were confirmed by sequencing (Eurofins MWG Operon, Hunstville, AL).

The full-length mouse Lmnb1 cDNA was amplified with primers: GCGCAGATCTATGGCGACCGCGACCCCCGTGCA and GCGCGGCGCGCCTCACATAATGGCACAGCTTTTATTC. The Lmnb1 cDNA was cloned into the pcDNA3.1mycBioID plasmid, which was created by Roux et al.18 (link) and was obtained from Addgene. To construct the lentivirus-based vectors, MycBirA* or MycBirA*-Lmnb1 fragments were amplified and cloned into the lentiviral plasmid. To construct the MycBirA*-macroH2A1 vector, human macroH2A1 cDNA was amplified using primers: GGCCGCGGCCGCATGTCGAGCCGCGGTGG, and GGCCGAATTCCTAG TTGGCGTCCAGCTTGG. The macroH2A1 cDNA was cloned into pcDNA3.1mycBioID vector. All constructs were verified by DNA sequencing.