Pellet pestle cordless motor

70–120 mg tissues were lysed in 5 μL/mg tissue RIPA buffer (Sigma) with 1× Complete protease inhibitors and 1 U/μL Superase In RNase inhibitor (Thermo Scientific) using Fisherbrand Pellet Pestle Cordless Motor. Afterwards, homogenization debris was removed by centrifugation at 20.800 × g for 10 min at 4°C. Protein concentration was determined using APA assay (Cytoskeleton Inc) and 50 μg total protein were separated on SDS-PAGE followed by western blot. Membranes were stained with anti-Naa10, anti-Naa15, and anti-GAPDH antibodies (all Abcam).
For RNA purification, 30 μL clarified lysates were mixed with 70 μL RNase free water and RNA isolated using the RNeasy Mini Kit (Qiagen) according to the manufacturers recommendations, including on-column Dnase digest. 1 μg RNA was reverse transcribed using the TaqMan Reverse transcription kit and gene level detection performed using SYBR Green Master Mix (all Thermo Scientific). Relative expression was normalized to GAPDH and ACTB.
For the characterization of the mNaa12 antibody, tissue was lysed in 2 µL per mg tissue PBS-X (PBS + 0.2% [v/v] Triton X-100 + 1× Complete protease inhibitor cocktail). 10–200 µg lysate were subjected to SDS-PAGE and western blot.

Organs from mice were dissected >2 months after birth. 70–120 mg tissue (heart/kidney/liver) were lysed in 5 μl/mg tissue RIPA buffer (Sigma) with 1x Complete protease inhibitors and 1 U/μl Superase In (Thermo Scientific, Waltham, MA, USA) using Fisherbrand Pellet Pestle Cordless Motor. After homogenization debris was removed by centrifugation at 20.800 g for 10 min at 4°C. Protein concentration was determined using APA assay (Cytoskeleton Inc. Denver, CO, USA) and 50 μg total protein were separated on SDS-PAGE followed by western blot. Membranes were stained with anti-Naa10, anti-Naa15 and anti-GAPDH antibodies (all Abcam, Waltham, MA,USA). For RNA purification, 30 μl clarified lysate were mixed with 70 μl RNase free water and RNA isolated using the RNeasy Mini Kit (Qiagen, Germantown, MA, USA) according to the manufacturer’s recommendations, including on-column Dnase digest. 1 μg RNA was reverse transcribed using the TaqMan Reverse transcription kit and gene level detection performed using SYBR Green
Master Mix (all Thermo Scientific). Relative expression was normalized to GAPDH and ACTB. The following primer pairs were used:
Naa10 (exon2-4) CTCTTGGCCCCAGCTTTCTT & TCGTCTGGGTCCTCTTCCATNaa11 ACCCCACAAGCAAAGACAGTG & AGCGATGCTCAGGAAATGCTCTGAPDH AGGTCGGTGTGAACGGATTTG & TGTAGACCATGTAGTTGAGGTCAACTB GGCTGTATTCCCCTCCATCG & CCAGTTGGTAACAATGCCATGT

Mouse kidneys were surgically removed from the wild-type Balb c mice as well as Aqp2CreTsc2^fl/fl mice under the influence of terminal anesthesia. Kidneys were immediately processed for EV isolation. Kidneys were homogenized in tissue protein extraction (T-PER) reagent (ThermoFisher, Waltham, MA, USA, Cat #78510) in a ratio of 1:20 (tissue:reagent, w/v) using Fisher brand Pellet Pestle Cordless Motor (Cat #12-141-361), as per the manufacturer’s instructions. The homogenized mixture was spun for 15 min at 1200× g to remove the cell debris. The resultant supernatant was centrifuged again at 2000× g for 10 min to remove any remaining debris, followed by filtration through a 0.45 μm filter; 500 µL of supernatant was utilized for the EV-isolation [58 (link)].