Puc57 plasmid

The RSV viral load in the lung was accessed by RSV F protein gene expression using the indicated specific primers and probes: forward primer 5’-AACAGATGTAAGCAGCTCCGTTATC-3’, reverse primer 5’-GATTTTTATTGGATGCTGTACATTT-3’, and probe 5’FAM/TGCCATAGCATGACACAATGGCTCCT-TAMRA/-3’. Primer sequences were synthesized and cloned into pUC57 plasmids (GenScript, Piscataway, NJ, USA), to perform a 10-fold dilution to generate a standard curve for viral load calculation. The values obtained from viral copies (based on concentration of the plasmid control) were calculated relative to the weight of the pre-weighed lung portion of 100 mg (copies per gram of lung). To access the replicative RSV particles, the right lungs were homogenized, centrifuged and the supernatant were collected, then inoculated onto Vero cell monolayers. Viral PFUs were determined using an anti-RSV (1:500, Millipore Cat# AB1128, RRID: AB_90477) antibody after 4 days.

DNA oligonucleotides were purchased from Sigma-Aldrich (Ishikari, Japan), and stored as 100 mM stock solutions in 10 mM Tris-HCl with 1 mM EDTA (pH 8.0). WT human genomic DNA was purchased from Promega (Tokyo, Japan). Heterozygote human genomic DNA with seven mutations (G12A, G12C, G12D, G12R, G12S, G12V and G13D) in the KRAS gene codon 12 and 13 were obtained from Horizon Diagnostics (Cambridge, UK). Eprobes (shown in Table I) were obtained from K.K. DNAFORM (Yokohama, Japan). Point mutations in codon 12 of the KRAS gene (GAT, GCT, GTT, AGT, TGT) were cloned into the plasmid pGEM-T (Promega) as previously described (26 (link)) and stored in glycerol at −80°C for long-term conservation. Point mutation of codon 13 (GAC) in the KRAS gene was prepared using the same protocol. The KRAS codon 12 (CGT) point mutation was prepared using the synthetic DNA ordered and inserted into a pUC57 plasmid (GenScript, Tokyo, Japan). The sequences of WT and all seven mutant clones were verified on ABI PRISM 3100 Avant (Applied Biosystems, Tokyo, Japan), diluted in TE buffer and stored at −20°C until use.

Double-stranded DNA of the intra-molecular FRET pair genes ECFPΔC11 and cp173Venus (Nagai et al., 2004 (link)), flanked by HIV-1 protease cleavage sites (AA: SQNYPIVQ, NA: TCGCAGAACTATCCAATTGTACAA) and containing the 3′ end of HIV-1 5′ LTR, HIV-1 Gag MA and the 5′ end of HIV-1 Gag CA domain sequences was synthesized (Supplementary Table 1) and cloned into the pUC57 plasmid (GenScript). The synthesized FRET DNA and pHIV Gag-iGFP (Hubner et al., 2007 (link)) plasmids were digested with BssHII and SphI restriction enzymes (New England Biolabs, Inc), purified with the QIAquick Gel Extraction Kit (QIAGEN), and ligated by T4 DNA ligase (New England Biolabs, Inc) to obtain the pHIV-1 Gag-iFRET plasmid. The protease defective mutant HIV-1 Gag iFRETΔPro, was generated by replacing the DNA region in pHIV-1 Gag-iFRET digested by SphI and SbfI with the extracted fragment of the previously reported protease defective NL4-3 construct, pNL-Hc (Adachi et al., 1991 (link)).

HEK293 cells were purchased from the American Type Culture Collection. Cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum in a humidified incubator with 5% CO₂ at 37°C.
The sequence of human CORIN encompassing rs3749585(T/C) was GACTGTGAAGAGCTGCCTGCAGAGAGCTGTACAGAAGCACTTTTCATGGACAGAAATGCTCAATCGTGCACTGCAAATTTGCATGTTTGTTTGGACTAATTTTTTTCAATTTATTTTTTCACCTTCATTTTTCTCTTATTTCAAGTTCAATGAAAGACTTTACAAAAGCAAACAAAGCAGACT. The sequences of rs3749585 TT and CC were synthesized and were inserted into PUC57 plasmid by GenScript Company (Nanjing, China), referred to as PUC57-CORIN-rs3749585-TT and PUC57-CORIN-rs3749585-CC, respectively. The PUC57-CORIN-rs3749585-TT and PUC57-CORIN-rs3749585-CC were digested with XhoI and NotI, and the PCR products were subcloned into the pYr-MirTarget luciferase plasmid, resulting in pYr-MirTarget-CORIN-rs3749585-TT and pYr-MirTarget-CORIN-rs3749585-CC. The primers used for Colony PCR were 5'-GGTTCTTTTCCAACGCTATT-3' (forward) and 5'-GACTCATTTAGATCCTCACAC-3' (reverse).
MiRNAs mimics were used to upregulate the expression of miRNAs, and negative control (NC) was used as control. MiRNAs were purchased from GenePharma Limited Company (Shanghai, China).

For expression in cells, constructs were synthesized by Genescript and cloned into a modified pUC57 plasmid (GenScript) allowing mammalian expression under a EF1a promoter. Target peptides were cloned as C-terminal fusions with a linker (GAGAGAGRP) followed by EGFP. Binders were expressed as fusions with an N-terminal Mito-Tag—the first 34 residues of the Mas70p protein, shown to efficiently relocalize proteins to mitochondria in mammalian cells^{50 (link)} —and a C-terminal mScarlet tag^{51 (link)}. Plasmids encoding the GFP-tagged peptide and the mScarlet-tagged binder were then cotransfected into cells.
Alternatively, for an in vivo demonstration of the multiplexed binding between different peptides and their cognate binders (Fig. 3f,g), bicistronic plasmids were generated expressing the binder flanked with a Mito-Tag followed by a stop codon, then an internal ribosome entry site (IRES) sequence and the target peptide tagged with EGFP. Alternatively, the binder was flanked with a PEX tag—the first 66 residues of human PEX3, targeting to peroxisomes^{52 (link)}—and the target peptide was tagged with mScarlet. Cells were then cotransfected with both bicistronic plasmids to express all four proteins.