The largest database of trusted experimental protocols

13 protocols using anti lamin b

1

Mitochondrial Dysfunction and Cell Death

Check if the same lab product or an alternative is used in the 5 most similar protocols
TMZ, Compound C, AICAR, Mdivi1, MG132 and WY14643, were purchased from MedChemExpress company. MTT and N‐Acetyl‐L‐cysteine (NAC) were purchased from Sigma‐Aldrich. MitoTracker™ Red FM (M22425), Hoechst 33342 (H1399) and anti‐Ubiquitin WB Antibody (13–1600) were purchased from Invitrogen (Thermo Fisher Scientific, Inc.) (1:1,000). Anti‐phospho‐Ubiquitin (Ser65) (ABS1513‐I) was purchased from Merck KGaA company (1:1000). Anti‐P53 (21891–1‐AP), anti‐PINK1 (23274–1‐AP), anti‐Parkin (14060–1‐AP), anti‐Drp1 (12957–1‐AP), anti‐Opa1 (27733–1‐AP), anti‐Mfn1 (13798–1‐AP), anti‐Mfn2 (12186–1‐AP), anti‐Caspase‐9 (10380–1‐AP), anti‐BAX (50599–2‐Ig), anti‐Caspase‐3 (19677–1‐AP), anti‐VDAC1 (10866–1‐AP), anti‐Lamin B (12987–1‐AP), anti‐Cytochrome c (10993–1‐AP), and anti‐β‐actin (60008–1‐Ig) were purchased from ProteinTech Group, Inc., (Chicago, IL, USA) (1:1,000). Anti‐γ‐H2A.X (ab81299) was purchased from Abcam (1:1000). Anti‐AMPKα (2532) and p‐AMPKα (50081) were purchased from Cell Signaling Technology, Inc. (Massachusetts, USA) (1:1000). Anti‐phospho‐DRP1(Ser616) (DF2972) was purchased from Affinity Biosciences (1:1000). Anti‐phospho‐DRP1(Ser637) (6319S) was purchased from Cell Signaling Technology, Inc. (1:1,000).
+ Open protocol
+ Expand
2

Western Blot Analysis of EMT Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
WB was performed as previously described34 (link), using monoclonal anti-LIMK2 (1:1000; Abcam, Cambridge, MA, USA) and polyclonal anti-LIMK2 (1:1000; Proteintech, Chicago, IL, USA), anti-E-cadherin, anti-Vimentin, anti-Met, anti-c-myc, anti-c-jun (1:1000; Cell Signaling Technology, Danvers, MA, USA), anti-LIMK1, anti-β-catenin, anti-lamin B (1:1000; Proteintech, Chicago, IL, USA). The loading control was a mouse anti-GAPDH monoclonal antibody (1:10000; Proteintech, Chicago, IL, USA).
+ Open protocol
+ Expand
3

Evaluating Neurodegenerative Disease Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
EGFP‐TFEB WT (38,119), mRFP‐GFP‐LC3B (84,573), EGFP‐α‐synucleinA53T (40,823), and PHM‐α‐synucleinA53T (40,825) were supplied by Addgene. GFP‐Adenovirus (AdV) and A53T‐AdV were purchased from Obio Technology. Corp. Ltd. anti‐α‐synuclein (10842‐1‐AP), anti‐PARP1 (13371‐1‐AP), anti‐TFEB (13372‐1‐AP), anti‐m‐TOR (20657‐1‐AP), anti‐LAMP1 (21997‐1‐AP), and anti‐Lamin B (12987‐1‐AP) were purchased from Proteintech; anti‐p‐m‐TOR (#5536), anti‐SIRT1 (#8469), anti‐β‐ACTB (#4970), anti‐LC3B A/B (#4211), and anti‐PGC‐1α (#2178s) were purchased from CST; anti‐TH (Santa, sc‐25269); anti‐γ‐H2A.X (Abcam, ab243906); anti‐PAR (Trevigen,4335‐MC‐100); Veliparib (Selleck, s1004); Veliparib (TargetMol; T2591); SRT2104 (Selleck, s7792); EX527(Selleck, s1541); CQ (Selleck, s8808); rapamycin (MedChenExpress, HY‐10219); and KPT‐330 (Selleck, s725).
Primers:
ACTB: F‐CATTGCTGACAGGATGCAGAAGG‐, R‐TGCTGGAAGGTGGACAGTGAGG‐
LC3B: F‐GGACCTGCTGCTTCTCTAA‐, R‐ACTGCTGAGTGAAAGGGTGT‐
LAMP1: F‐AGCCCTGGAATTGCAGTTTG‐, R‐CACTGTCCACCTTGAAAGCC‐
α‐synucleinA53T‐tg: F‐TGTAGGCTCCAAAACCAAGG‐, R‐TGTCAGGATCCACAGGCATA‐
siPARP1: F‐GCAGCGAGUAGUAUUCCCAAdTdT‐, R‐UUGGGAAUACUCUCGCUGCdTdT‐;
siSIRT1: F‐ACGAUGACAGAACGUCACAdTdT‐, R‐UGUGAGUUCUGUCAUCGUdTdT‐
+ Open protocol
+ Expand
4

Recombinant Cytokine Signaling Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant human IL-1β, IL-6, IL-17α, and TNF-α were obtained from R&D Systems (Bio-Techne), and LPS was purchased from MilliporeSigma. DMEM, FBS, antibiotics, trypsin EDTA, PBS, and other products for cell culture were obtained from Invitrogen, Thermo Fisher Scientific. The primary antibodies used were as follows: anti–HIF-1α (catalog number 36169), anti-LRRK2 (catalog number 5559), anti-CDC42 (catalog number 2466), and anti-RhoA (catalog number 2117) were purchased from Cell Signaling Technology. Anti–alpha Tubulin (catalog number ab7291) and anti-PTK6 (catalog number ab233392) were purchased from Abcam. Anti-Rac1 (catalog number 05-389) was purchased from MilliporeSigma. Anti–Lamin B (catalog number 66095-1-Ig) was obtained from Proteintech.
+ Open protocol
+ Expand
5

NLRP12 Signaling Pathway Analysis in Bone Marrow Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The mEB8 and mouse bone marrow progenitor cells were lysed with RIPA buffer after twice washing with PBS. Then the proteins were quantified by BCA Protein Assay Kit. Primary antibodies used in western blotting were anti-NLRP12 (SAB3500555; Sigma-Aldrich), anti-NIK (AB191592; Abcam), anti-Relb (AB180127; Abcam), anti-ERK1/2 (9102; CST), anti-phospho-ERK1/2 (9101; CST), anti-p38 (9212; CST), anti-phospho-p38 (4511; CST), anti-JNK (9252; CST), anti-phospho-JNK (9255; CST), anti-Gapdh (HC301; Transgen Biotech.) and anti-laminb (66095; Proteintech). The blot was detected with horseradish-peroxidase-labeled anti-rabbit (7074S; CST) or anti-mouse secondary antibody (7076S; CST) and ECL Plus solution (WBKLS0500; Millipore).
+ Open protocol
+ Expand
6

Nuclear and Cytoplasmic Fractionation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell fractionation assays were performed according to protocols of the NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific). The purity of nuclear and cytoplasmic extracts was assessed by immunoblotting with anti-lamin B (proteintech) and either anti-α-tubulin or anti-GAPDH antibodies (proteintech), respectively.
+ Open protocol
+ Expand
7

Immunostimulatory Compound Screening Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Polymyristate-13-acetate (PMA), Polyinosinic–polycytidylic acid (poly (I: C)), Herring testis (HT) DNA, and dimethyl sulfoxide (DMSO) were all purchased from Sigma-Aldrich (Jefferson City, United States). 2'3'-cGAMP were purchased from InvivoGen. Penicillin-streptomycin 100× sterile (CC004) was purchased from MacGene (Beijing, China). StarFect High-efficiency Transfection Reagents were purchased from GenStar. DMXAA (HY-10964). DiABZI STING agonist-1 trihydrochloride (HY-112921B) was purchased from Med Chem Express (State of New Jersey, US). Rabbit monoclonal anti-Phospho-IRF-3 (1:1000,86691) was purchased from Gene Tex (China). Rabbit monoclonal anti-Phospho-IRF-3 (1:1000,76439) was purchased from Abcam. TMEM173/STING Polyclonal antibody (1:2000,19851-1-AP), IRF3 Polyclonal antibody (1:2000,11312-1-AP), Alpha Tubulin Monoclonal antibody (1:1500, 66031-1-Ig) and Anti Lamin B (1:1500, 66095-1-Ig) antibodies were purchased from Proteintech (Chicago, United States).
+ Open protocol
+ Expand
8

Investigating IL-33-mediated Inflammatory Responses

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies and reagents were obtained from the respective manufacturers: RP-MI-1640 medium (HyClone, South Logan, UT), fetal bovine serum (Gemini Bio, Sacramento, CA), penicillin–streptomycin (Solarbio, Beijing, China), Fluoromount with 4’, 6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, St. Louis, MO), Dulbecco’s Modified Eagle Medium (Gibco, Grand Island, NY), Acetaminophen (APAP) (Yuanye Bio-Tech Co., Shanghai, China), Lipofectamine 3000 (Invitrogen, Carlsbad, CA), Recombinant human IL-33 and mouse IL-33 (rhIL-33, Elabsceience Bio., Wuhan, China), puromycin (Solarbio), Sytox Green (Invitrogen, Carlsbad, CA), anti-Flag (ABMART, Shanghai, China), anti-Myc (ABMART), anti-HA (ABMART), anti-tubulin (ABMART), anti-LC3B (Cell Signaling Technology, Beverly, MA), anti-Beclin-1 (Cell Signaling Technology), anti-IRF3 (Cell Signaling Technology), anti-p-IRF3 (Cell Signaling Technology), anti-STING (Cell Signaling Technology), anti-ST2 (Proteintech, Wuhan, China), anti-LaminB (Proteintech, Wuhan, China), Protein A/G PLUS Agarose (ABMART). cGAS/STING inhibitor RU.521 (Synonyms: RU320521, CAS 2262452–06-0), 3-Methyladenine (3-MA) (CAS 5142–23-4), and MG132 (CAS 133407–82-6) were purchased from Merck, Darmstadt, Germany.
+ Open protocol
+ Expand
9

Nuclear and Cytoplasmic Protein Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Experiments were performed using the Nuclear and Cytoplasmic Protein Extraction kit (Beyotime). The cytoplasmic proteins were isolated first and the nuclear proteins were extracted in accordance with the instructions in the manual. For the western blotting assay, anti-GAPDH (Proteintech, 60004-1-Ig) was used as an internal reference for cytoplasmic proteins and anti-LaminB (Proteintech, 12987-1-AP) was used as an internal reference for nuclear proteins.
+ Open protocol
+ Expand
10

Inflammasome Activation Regulation Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
ATP, nigericin, and DMSO were obtained from Sigma. SiO2, Pam3CSK4, poly (dA:dT), and ultrapure lipopolysaccharide (LPS) were provided by InvivoGen. Dihydrotanshinone I (DHT) was purchased from MCE and Targetmol. Salmonella was supplied as a gift from Dr. Tao Li from the National Center of Biomedical Analysis (Beijing, China). MitoSOX was supplied by Invitrogen. Anti-mouse caspase-1 (1:1,000, AG-20B-0042) and anti-NLRP3 (1:2000, AG-20B-0014) were supplied from AdipoGen. Anti-ASC (1:1,000, #67824) and anti-GAPDH (1:1,000, #5174) were supplied by Cell Signaling Technology. Anti-mouse IL-1β (1:1,000, AF-401-SP) was obtained from R&D Systems. Anti-flag (1:1,000, 80010-1-RR), anti-NEK7 (1:1,000), and anti-lamin B (1:1,000, 10895-1-AP) were supplied by Proteintech. F4/80 (565,410) was obtained from BD Biosciences.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!