Log In Sign up
The largest database of trusted experimental protocols

Polr1a rpa194 c 1

Manufactured by Santa Cruz Biotechnology
Visit Supplier

POLR1A/RPA194 (C-1) is an antibody product offered by Santa Cruz Biotechnology. It is designed to detect POLR1A, the largest subunit of RNA polymerase I. This antibody can be used for applications such as western blotting, immunoprecipitation, and immunofluorescence analysis.

Automatically generated - may contain errors

Lab products found in correlation

Ncl 4e2, by Abcam (2 mentions) Npm fc 61991, by Thermo Fisher Scientific (2 mentions) Polr1b rpa135 4h6, by Santa Cruz Biotechnology (2 mentions) Alexa 594 conjugated anti mouse and anti rabbit antibodies, by Thermo Fisher Scientific (2 mentions) Dm6000b wide field fluorescence microscope, by Leica (2 mentions) Alexa 488, by Thermo Fisher Scientific (2 mentions) Orca flash4.0 v2 scmos camera, by Hamamatsu Photonics (2 mentions) Dc protein kit, by Bio-Rad (2 mentions) α tubulin, by Santa Cruz Biotechnology (2 mentions) Protease inhibitor, by Roche (2 mentions) Gapdh, by Cell Signaling Technology (2 mentions) Taf1c, by Abcam (2 mentions) Polr1b rpa135 h 15, by Santa Cruz Biotechnology (2 mentions) Rpa43 hpa022416, by Merck Group (2 mentions) Lamin a c h 110, by Santa Cruz Biotechnology (2 mentions) Ubf f 9, by Santa Cruz Biotechnology (2 mentions) Enhanced chemi luminescence (ecl), by PerkinElmer (2 mentions) Ideal chip seq kit, by Diagenode (1 mentions) Me220 focused ultrasonicator, by Covaris (1 mentions)

Spelling variants of this product

RPA194 (8 citations) RPA194 (C-1) (6 citations)

5 protocols using polr1a rpa194 c 1

1

Immunofluorescence Staining of Nucleolar Proteins

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For all immunofluorescence procedures, we followed our earlier protocols (Peltonen et al., 2014a (link)). Cells grown on coverslips were fixed in 3.5% paraformaldehyde or 100% methanol, permeabilized with 0.5% NP-40 lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.5% NP-40, and 50 mM NaF), and blocked in 3% BSA. The following primary antibodies were used: POLR1B/RPA135 (4H6; Santa Cruz Biotechnology), POLR1A/RPA194 (C-1; Santa Cruz Biotechnology), NPM (FC-61991; Invitrogen), NCL (4E2; Abcam), and fibrillarin (ab5821; Abcam). Secondary antibodies used were Alexa 488 and Alexa 594-conjugated anti-mouse and anti-rabbit antibodies (Invitrogen). DNA was stained with Hoechst 33342. Images were captured using DM6000B wide-field fluorescence microscope (Leica). The microscope was equipped with a Hamamatsu Orca-Flash 4.0 V2 sCMOS camera and LAS X software by using 40×/1.25–0.75 HCX PL APO CS oil and 63×/1.40–0.60 HCX PL APO Lbd.bl. oil objectives. Quantitative image analysis of nucleolar protein expression was as described in Peltonen et al. (2014a) (link) and was conducted on at least 200 cells per sample on three to five fields.
Wei T., Najmi S.M., Liu H., Peltonen K., Kucerova A., Schneider D.A, & Laiho M. (2018). Small-Molecule Targeting of RNA Polymerase I Activates a Conserved Transcription Elongation Checkpoint. Cell reports, 23(2), 404-414.
+ Open protocol
+ Expand
2

Quantitative Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in RIPA lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% NP-40, 0.1% SDS, and 1% sodium deoxycholate) supplemented with protease inhibitors (Roche), sonicated, and centrifuged at 13,200 rpm for 15 min. Protein concentrations were measured using the Dc-Protein Kit (Bio-Rad). Equal amounts of protein were separated on SDS-PAGE, blotted, probed for target proteins, and detected using ECL (Perkin Elmer). The primary antibodies used for detection were UBF (F-9; Santa Cruz Biotechnology), RRN3 (ab112052; Abcam), TAF1C (ab134394; Abcam), POLR1A/RPA194 (C-1; Santa Cruz Biotechnology), POLR1B/RPA135 (H-15; Santa Cruz Biotechnology), RPA43 (HPA022416; Sigma-Aldrich), α-tubulin (10D8; Santa Cruz Biotechnology), lamin A/C (H-110; Santa Cruz Biotechnology), and GAPDH (14C10; Cell Signaling Technology). Horseradish peroxidase (HRP)-conjugated secondary antibodies were from DAKO or Santa Cruz Biotechnology. Protein densitometry analysis was conducted using ImageJ software, and the mean value normalized with loading control was used as final protein band quantification.
Wei T., Najmi S.M., Liu H., Peltonen K., Kucerova A., Schneider D.A, & Laiho M. (2018). Small-Molecule Targeting of RNA Polymerase I Activates a Conserved Transcription Elongation Checkpoint. Cell reports, 23(2), 404-414.
+ Open protocol
+ Expand
3

ChIP-seq of POLR1A in Human Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were fixed with 1.1% formaldehyde for 6 minutes, washed with PBS, scraped, normalized according to cell numbers, and pelleted at 4°C using 500 x g. Lysis was completed using the iDeal ChIPseq kit (Diagenode, Cat# C01010170). Following chromatin isolation, chromatin was resuspended in iS1b buffer (Diagenode) and sheared using Covaris ME220 Focused-ultrasonicator. Immunoprecipitation was conducted using POLR1A/RPA194 (C-1; Santa Cruz Biotechnology) (5 μg) antibodies for 6 hours and the precipitates were collected on Dynabeads G beads (Thermo Fisher) at 4°C. The beads were washed, and the chromatin was eluted and purified. qPCR was conducted as above.
Primer pairs used were: Promoter -48 (forward GAGGTATATCTTTCGCTCCGAGTC, reverse CAGCAATAACCCGGCGG), 5’ETS 851 (forward GAACGGTGGTGTGTCGTT, reverse GCGTCTCGTCTCGTCTCACT), 18S 4446 (forward CCCGAAGCGTTTACTTTGAA, reverse CGGTCCAAGAATTTCACCTC), Terminator Tr1 13508 (forward ACCGCGGCCTTCTCCA, reverse TGCGGTTCGTCCCGAC), Terminator Tr2 15364 (forward GCCGTCAGCCAGTAATGCTT, reverse GAAAACGCAAGGCAAAACCA), IGS 30541 (forward ACTGGCGAGTTGATTTCTGG, reverse CGAGACAGTCGAGGGAGAAG).
Ford B.L., Wei T., Liu H., Scull C.E., Najmi S.M., Pitts S., Fan W., Schneider D.A, & Laiho M. (2023). Expression of RNA polymerase I catalytic core is influenced by RPA12. PLOS ONE, 18(5), e0285660.
+ Open protocol
+ Expand
4

Quantitative Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed in RIPA lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 1% NP-40, 0.1% SDS, and 1% sodium deoxycholate) supplemented with protease inhibitors (Roche), sonicated, and centrifuged at 13,200 rpm for 15 min. Protein concentrations were measured using the Dc-Protein Kit (Bio-Rad). Equal amounts of protein were separated on SDS-PAGE, blotted, probed for target proteins, and detected using ECL (Perkin Elmer). The primary antibodies used for detection were UBF (F-9; Santa Cruz Biotechnology), RRN3 (ab112052; Abcam), TAF1C (ab134394; Abcam), POLR1A/RPA194 (C-1; Santa Cruz Biotechnology), POLR1B/RPA135 (H-15; Santa Cruz Biotechnology), RPA43 (HPA022416; Sigma-Aldrich), α-tubulin (10D8; Santa Cruz Biotechnology), lamin A/C (H-110; Santa Cruz Biotechnology), and GAPDH (14C10; Cell Signaling Technology). Horseradish peroxidase (HRP)-conjugated secondary antibodies were from DAKO or Santa Cruz Biotechnology. Protein densitometry analysis was conducted using ImageJ software, and the mean value normalized with loading control was used as final protein band quantification.
Wei T., Najmi S.M., Liu H., Peltonen K., Kucerova A., Schneider D.A, & Laiho M. (2018). Small-Molecule Targeting of RNA Polymerase I Activates a Conserved Transcription Elongation Checkpoint. Cell reports, 23(2), 404-414.
+ Open protocol
+ Expand
5

Immunofluorescence Staining of Nucleolar Proteins

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
For all immunofluorescence procedures, we followed our earlier protocols (Peltonen et al., 2014a (link)). Cells grown on coverslips were fixed in 3.5% paraformaldehyde or 100% methanol, permeabilized with 0.5% NP-40 lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.5% NP-40, and 50 mM NaF), and blocked in 3% BSA. The following primary antibodies were used: POLR1B/RPA135 (4H6; Santa Cruz Biotechnology), POLR1A/RPA194 (C-1; Santa Cruz Biotechnology), NPM (FC-61991; Invitrogen), NCL (4E2; Abcam), and fibrillarin (ab5821; Abcam). Secondary antibodies used were Alexa 488 and Alexa 594-conjugated anti-mouse and anti-rabbit antibodies (Invitrogen). DNA was stained with Hoechst 33342. Images were captured using DM6000B wide-field fluorescence microscope (Leica). The microscope was equipped with a Hamamatsu Orca-Flash 4.0 V2 sCMOS camera and LAS X software by using 40×/1.25–0.75 HCX PL APO CS oil and 63×/1.40–0.60 HCX PL APO Lbd.bl. oil objectives. Quantitative image analysis of nucleolar protein expression was as described in Peltonen et al. (2014a) (link) and was conducted on at least 200 cells per sample on three to five fields.
Wei T., Najmi S.M., Liu H., Peltonen K., Kucerova A., Schneider D.A, & Laiho M. (2018). Small-Molecule Targeting of RNA Polymerase I Activates a Conserved Transcription Elongation Checkpoint. Cell reports, 23(2), 404-414.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!