HSPCs were cultured and prestimulated for 72 h after thaw and before gene editing. Chemically modified CD123 sgRNA and CCR5 sgRNA were synthesized by Synthego Corporation. SpyFi Cas9 was purchased from Aldevron, LLC. CD123-E51K and CD123-E51T donor rAAV6 virus were purchased from SignaGen Laboratories. CCR5-KO donor rAAV6 virus was produced in HEK-293T cells and purified with AAVpro Purification Kit (TakaRa). Electroporation of the RNP complex was performed using the Lonza 4D-Nucleofector (Lonza Group Ltd.) in P3 Primary Cell Solution with program DZ-100. Donor rAAV6 virus was immediately dispensed onto electroporated cells at a multiplicity of infection (MOI) of 2.5 × 103 vector genomes per cell for CD123 and 5.0 × 103 vector genomes per cell for CCR5 based on the titers determined by droplet digital PCR. The cells were then divided into two halves at 2.5 × 105 cells/ml. One half was plated in SCGM medium supplemented with cytokines and 10 ng/ml IL-3 (PeproTech) as +IL-3 treatment. The other half was plated in SCGM medium supplemented with cytokines only as −IL-3 treatment. After incubation for 24 h, a medium change was performed to remove residual rAAV6 virus. The CD34+ HSPCs were cultured for up to 8 d for quantification of gene editing events, CFU assays, and pSTAT5 staining and FACS analysis.
Spyfi cas9
Manufactured by Aldevron
The SpyFi Cas9 is a laboratory equipment product designed for genetic engineering applications. It functions as a programmable RNA-guided endonuclease that can be used to target and modify specific DNA sequences. The core function of the SpyFi Cas9 is to facilitate precise genome editing, enabling researchers to introduce desired changes or disrupt targeted genes.
Automatically generated - may contain errors
Lab products found in correlation
Aavpro purification kit, by Takara Bio (1 mentions)
Interleukin 3 (il 3), by Thermo Fisher Scientific (1 mentions)
4d nucleofector, by Lonza (1 mentions)
Sf cell line 4d nucleofector x kit s, by Lonza (1 mentions)
Nucleofector solution sf, by Lonza (1 mentions)
Gene knockout kits v2, by Synthego (1 mentions)
Amaxa 4d nucleofector x unit, by Lonza (1 mentions)
4d nucleofector x unit, by Lonza (1 mentions)
Plenticrispr v2, by GenScript (1 mentions)
P3 primary cell kit, by Lonza (1 mentions)
3 protocols using spyfi cas9
1
Efficient HSPC Gene Editing via Electroporation
2
Pooled Knockout Cell Line Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pooled knockout cell lines were generated by electroporating Cas9-guide RNA ribonucleoprotein (RNP) complexes into reporter K562 cells using an Amaxa 4D Nucleofector X Unit (Lonza) and the SF Cell Line 4D-Nucleofector X Kit S (Lonza). Gene Knockout Kits v2 (Synthego) composed of three unique guide RNAs per target were ordered for each gene of interest. Guide RNAs were resuspended in 10 mM Tris, 1 mM EDTA pH 8.0 to a final concentration of 100 µM. Cas9 RNPs were generated by incubating 0.6 µl SpyFi Cas9 (Aldevron) and 1 µl (3.2 µg) guide RNA per gene target at room temperature for 10 min before electroporation. 2 × 105 cells were resuspended in 20 µl Nucleofector Solution SF (Lonza), combined with the assembled Cas9 RNPs, and the cells were electroporated in a 16-well cuvette using program FF-120.
Variable guide RNA sequences included in the Synthego Gene Knockout Kits for RNF185, RNF5, and UBE2D3 were: CAGCCAAGGAUGGCAAGCAA (RNF185 #1), AAUGGCGCUGGCGAGAGCGG (RNF185 #2), CAGGCUGAUGACGGCAUCCU (RNF185 #3), GUCUCUCACCUGGGAUCCUG (RNF5 #1), UCUUCCACACCGUUUUCCAA (RNF5 #2), GGCUGGAGACACGGCCAGAA (RNF5 #3), UAGAGCAUUCUUGGAAGAUA (UBE2D3 #1), UGAGGGAAAAUACUUGCCUU (UBE2D3 #2), and CAGAAUGACAGCCCAUAUCA (UBE2D3 #3). A synthetic sgRNA against the AAVS1 safe-harbor locus served as a control guide (guide sequence: GGGGCCACUAGGGACAGGAU [Amrani et al., 2018 (link)]).
Variable guide RNA sequences included in the Synthego Gene Knockout Kits for RNF185, RNF5, and UBE2D3 were: CAGCCAAGGAUGGCAAGCAA (RNF185 #1), AAUGGCGCUGGCGAGAGCGG (RNF185 #2), CAGGCUGAUGACGGCAUCCU (RNF185 #3), GUCUCUCACCUGGGAUCCUG (RNF5 #1), UCUUCCACACCGUUUUCCAA (RNF5 #2), GGCUGGAGACACGGCCAGAA (RNF5 #3), UAGAGCAUUCUUGGAAGAUA (UBE2D3 #1), UGAGGGAAAAUACUUGCCUU (UBE2D3 #2), and CAGAAUGACAGCCCAUAUCA (UBE2D3 #3). A synthetic sgRNA against the AAVS1 safe-harbor locus served as a control guide (guide sequence: GGGGCCACUAGGGACAGGAU [Amrani et al., 2018 (link)]).
3
CRISPR-Mediated Gene Knockout in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the deletion of Csf-1, the ESCC cell lines were nucleofected with 2.5μg of Spyfi Cas9 (Aldevron, 9214) and two pairs of gRNAs (Synthego, Supplementary Table S1) using a ribonucleoprotein (RNP) approach. The Amaxa Lonza 4D Nucleofector X-Unit (Lonza, AAF-1003X) and P3 Primary Cell kit (V4XP-3024) protocol CB-150 was used for the nucleofections. 48-post nucleofection, the mixed population was sorted into 96-well plates as single cells and incubated for 3 weeks before the colonies were expanded and genotyped for the assessment of indels introduced. Colonies with homozygous indels were verified by qRT-PCR and ELISA. Deletion of TP53 in LS123 or TE11 cells was achieved by infecting pLentiCRISPR v2 (GenScript) with human TP53 sgRNA (Supplementary Table S1) or an empty control vector. The cells were sorted 48 hours after the infection into single cell colonies in 96-well plates and treated with 1.5μg/mL or 2.0μg/mL Puromycin for 2 weeks, respectively. Viable colonies were expanded and the p53 levels were verified by immunoblotting.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!