Viral load was detected by quantitative real-time PCR (qRT-PCR) on RNA extracted from the supernatant of lung homogenates as described previously (Cao et al., 2020 (link)). Briefly, lung homogenates were prepared by homogenizing perfused whole lung using an electric homogenizer. The supernatant was collected, and total RNA was extracted. Each RNA sample was reverse transcribed to 50 μL cDNA with RT-PCR Prime Script Kit (Takara). The cDNA (5 μl) was used in a 25 μL qRT-PCR reaction with the TaqMan Universal PCR Master Mix (Life Technologies), a TaqMan probe (5′-FAM− CAGGTGGAACCTCATCAGGAGATGC −MGB-3′), and primers designed to target the orf1ab gene of SARS-CoV-2 (5′- GTGARATGGTCATGTGTGGCGG −3′ and 5′- CARATGTTAAASACACTATTAGCATA −3′). The samples were run in triplicate on an ABI 7900 Real-Time System (Applied Biosystems, Thermo Fisher Scientific). The following cycling conditions were used: 1 cycle of 50°C for 2 min, 1 cycle of 95°C for 10 min, and 40 cycles of 95°C for 15 s and 58°C for 1 min. The virus titer was determined by comparison with a standard curve generated using RNA extracted from a serially diluted reference viral stock. All experiments were performed in a Biosafety Level 3 facility.
Rt pcr prime script kit
Manufactured by Takara Bio
Sourced in United States
The RT-PCR Prime Script Kit is a reagent kit designed for reverse transcription and subsequent real-time PCR amplification. It includes all the necessary components for the two-step RT-PCR process, including reverse transcriptase enzyme, primers, and reaction buffers.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Quick rna viral kit, by Zymo Research (2 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions)
Abi7900 real time system, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Qiaamp viral rna mini kit, by Takara Bio (1 mentions)
Pcr master mix, by Takara Bio (1 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
Hiscript 3 rt supermix for qpcr gdna wiper kit, by Vazyme (1 mentions)
4 protocols using rt pcr prime script kit
1
SARS-CoV-2 Quantitative Real-Time PCR Protocol
2
Quantitative RT-PCR for SFTSV RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The viral RNA in cellular supernatant, cells, patients and mouse’ serum were extracted using Quick-RNA Viral Kit (ZYMO Research, CA, USA) or TRIzol reagent (Thermo Fisher Scientific, MA, USA) and cDNAs were generated at 37 °C for 15 min, 85 °C for 5 s, and 37 °C for 10 min using RT-PCR Prime Script Kit (Takara, CA, USA). Quantitative real-time PCR analyses for mRNAs of SFTSV was performed by using TaqMan® Gene Expression Assays (Thermo Fisher, USA) and ABI 7500 Real-time PCR system (Life Tech, USA) according to the manufacturer’s procedure (Yu et al, 2011 (link)). The primer set was as below: forward primer: 5′-TGGTGGATGTCATAGAGG G-3′, reverse primer: 5′-CTGTGTTCACTGTTGATTTCTC-3′, probe: 5′-AGCATACGCCCTAAG TCAGACATGGATGA-3′. Viral copy numbers were calculated as a ratio with respect to the standard control (Shimada et al, 2015 (link)). Gene expression of relative fold change, recorded as cycle threshold (Ct), was normalized against an internal control (GAPDH).
3
Quantitative RT-PCR for HIV-1 Viral Load
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HIV-1 RNA was extracted using the QIAamp viral RNA mini kit and reverse transcribed to cDNA with the RT-PCR Prime Script Kit from Takara. Then, 2 μL cDNA was used in a 20 μL qRT-PCR reaction using the Takara PCR Master Mix with the specific HIV-1 P17 gene primers (5′-TCTCGA CGCAGG ACTCG-3′ and 5′-TACTGA CGCTCT CGCACC-3′) and a TaqMan probe (5′-FAM-CTCTCT CCTTCT AGCCTC-MGB-3′), in the following conditions: 1 cycle of 50 °C for 2 min, 1 cycle of 95 °C for 10 min and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The HIV-1 viral titer was determined via comparison with a standard curve generated using RNA extracted from a serially diluted reference HIV-1 viral stock.
4
SFTSV Viral Load Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The viral RNA in mouse sera and tissues were extracted using Quick-RNA Viral Kit (ZYMO Research, CA, USA) or TRIzol reagent (Thermo Fisher Scientific, MA, USA) and cDNAs were generated by reverse transcription using RT-PCR Prime Script Kit (Takara, CA, USA) or HiScript III RT SuperMix for qPCR (+gDNA wiper) Kit (Vazyme, Nanjing, China). Viral copy numbers were determined by real-time RT–PCR with an L segment-based SFTSV-specific primer set (SFTS-LF’: TGGTGGATGTCATAGAAGGC and SFTSV-LR’: GAGTAATCCTCTTGCCTGCT). Viral copy numbers were calculated as a ratio with respect to the standard control [14 (link)]. Gene expression of relative fold change, recorded as cycle threshold (Ct), was normalized against an internal control (GAPDH). Real-time PCR was performed using a SYBR Green Supermix (Bio-Rad, CA, USA) and determined on Applied Biosystem 7500 (Life Tech, NY, USA) according to the manufacturer’s procedure [1 (link),45 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!