Lentivirus vector

PC3 cells were maintained in DMEM-F12 medium (Gibco, NY, USA) enriched with 10% fetal bovine serum (VivaCell, China) and supplemented with 1% streptomycin-penicillin (Gibco, NY, USA). In a similar fashion, 22RV1 and LNCaP cells were cultured in RPMI-1640 medium (Gibco, NY, USA) containing 10% fetal bovine serum (VivaCell, China) and 1% penicillin–streptomycin (Gibco, NY, USA). RWPE-1 cells were sustained in a specialized medium for RWPE-1 cells (ZQ-1303, ZQXZ Bio, Shanghai, China). All four cell types were incubated at 37 °C in a humidified atmosphere containing 5% CO₂.Small interfering RNA (siRNA) targeting circ_0001671 and vectors designed to elevate miRNA expression levels (miRNA-mimic) were synthesized by GenePharma (Shanghai, China). Vectors to augment circRNA expression (over-circRNA) were engineered by Tsingke (Chongqing, China). The lentivirus vector was acquired from Shanghai Genechem (Shanghai, China). Transfection was performed using specific vectors (si-circRNA, over-circRNA, miRNA mimic at a concentration of 100 nM) and FuGENE HD (Promega, Madison, WI, USA), as per the manufacturer's guidelines. Following transfection, cells were utilized in subsequent experiments.

The full‐length sequence or shRNA of FGF19 were constructed into the lentivirus vector (GeneChem, Shanghai, China). The target sequences for shFGF19s were as follows: ACTTGTCTGATCATAACATTG (shFGF19#1); CCTGGGACAACTTGAGAATTC (shFGF19#2).
Transfection experiments were executed according to the manufacturer's instructions. Briefly, 5 × 10⁵ CRC cells were seeded into 6‐well plates the day before transfection. The lentivirus was premixed with 40 µL HiTransG P (GeneChem) and subsequently added to CRC cells with 1 mL complete DMEM medium. After 24 h, the medium was replaced with fresh culture medium. Stable cell lines were selected using puromycin (8 µg mL⁻¹) incubation for 7 days. The efficiency of knockdown and overexpression were verified by WB.

Lentivirus vector carrying the luciferase gene (Luc) and the human FSTL1 sequence (FSTL1) or the FSTL1-repressing shRNA sequence (GCCCAGTTGTTTGCTATCACT, FSTL1-sh) were purchased from Genechem (Shanghai, China). An empty vector (Vector) was used as control to FSTL1 overexpression. Lentivirus containing a scramble sequence (FSTL1-scramble) was used as control to FSTL1-shRNA. According to the manufacturer’s instructions, stable cell lines were established by transfection of CRC cells with these Lentivirus vectors. Antibiotic-resistant transfected cells were selected via puromycin (Sigma, USA) administration in the culture medium. FSTL1 transfection efficiency was assessed by quantitative real-time PCR (qRT-PCR) and western blotting, respectively.

HCT116 and RKO cells (ATCC, Manassas, Virginia, USA) were cultured in Dulbecco’s modified Eagle medium (DMEM) (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (FBS) (Invitrogen) at 37 °C in a humidified atmosphere of 5% CO₂.
Lentivirus vector carrying human 4IgB7-H3 cDNA was generated by Genechem Co., Ltd (Shanghai, China). An empty backbone vector was used as a control. For lentivirus infection, HCT116 cells or RKO cells were grown to 30% confluence in 6-well plates and were infected with lentiviral particles at a multiplicity of infection (MOI) of 20. The infection efficiency was confirmed by counting GFP-expressing cells under fluorescence microscopy 72 h after infection.
Human B7-H3 siRNA-1 (5′-GCUGUCUGUCUGUCUCAUUTT-3′), human B7-H3 siRNA-2 (5′-GUGCUGGAGAAAGAUCAAATT-3′), human HK2 siRNA (5′-CACGATGAAATTGAACCTGGT-3′) and their control siRNA were purchased from GenePharma Co. Ltd. (Suzhou, China). HCT116 or RKO cells were transfected with siRNA reagents using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Transfection efficiency was determined by RT-qPCR and western blot.

Lentivirus vector containing ITGB1 (Len-Itgb1) was constructed by GeneChem (Shanghai, China) using the procedures reported previously (Wang K. et al., 2013 (link)). Briefly, rat Itgb1 cDNA (Accession No: NM_017022.2) was amplified by PCR with the following primers: forward, 5′- GAG GAT CCC CGG GTA CCG GTC GCC ACC ATG AAT TTG CAA CTG GTT TTC TG -3′; and reverse, 5′- TCA CCA TGG TGG CGA CCG5 GTT TTC CCT CAT ACT TCG GAT TG -3′. PCR conditions were pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 12 s, annealing at 57°C for 45 s; and a final extension at 37°C for 1 min. The amplified sequence was digested with Age I and then inserted into GV218 lentiviral vector (GeneChem, Shanghai, China) to get Len-Itgb1. DNA sequencing was performed to verify the sequence of the insert and the identities were 100%. Western blot analysis was employed to confirm the overexpression of Itgb1 in transfected 293 T cells. Lentivirus without the insertion of Itgb1 (Len-null) but only expressing enhanced green fluorescent protein (EGFP) was routinely made as a control.