Northernmax kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, Japan

The NorthernMax Kit is a laboratory equipment product designed for Northern blot analysis. It provides the necessary reagents and materials to perform this well-established RNA detection and quantification technique.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Ambion Northernmax Kit

93 protocols using northernmax kit

Detecting HIV-1 Genomic RNA via Northern Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

Timing: 2 days

The purpose of this assay is to specifically detect HIV-1 genomic RNA and its length using Northern blot. This is an optional step depending on the use of HIV-1 RNA.

16.

Perform denaturing urea gel electrophoresis according to the previous section using 3 μg RNA per well.

17.

Perform Northern blot using the NorthernMax™ Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol which can be found here: NorthernMax Kit.

18.

Perform Nonisotopic probe detection using the Chemiluminescent Nucleic Acid Detection Module (Thermo Fisher Scientific) according to the manufacturer’s protocol which can be found here: Chemiluminescent Nucleic Acid Detection Module.

Alternatives: Once the protocol is well-established it is not strictly necessary to perform Northern blotting for every experiment.

Phillips S., Baek A., Kim S., Chen S, & Wu L. (2022). Protocol for the generation of HIV-1 genomic RNA with altered levels of N6-methyladenosine. STAR Protocols, 3(3), 101616.

+ Open protocol

+ Expand

Northern Blot Analysis of S. aureus RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Northern blots were performed using a NorthernMax kit (Ambion) according to the manufacturer’s instructions. Briefly, 1.5 μg of total RNA for each strain of S. aureus were separated on a 1% MOPS (morpholinepropanesulfonic acid)-formaldehyde-agarose gel and transferred to a BrightStar-Plus positively charged nylon membrane (Invitrogen) using a Whatman Nytran SuPerCharge TurboBlotter kit (GE Healthcare Life Sciences) for 3.5 h. Samples were cross-linked to the membrane by baking at 80°C for 20 min. Biotin-labeled RNA probes were synthesized from DNA with gene-T7-specific primer sets (see Table S1 in the supplemental material) using a MaxiScript T7 transcription kit (Thermo Fisher), including the optional DNase digestion and cleanup with NucAway spin columns (Invitrogen). Probes were added to 10 ng/ml in Ultrahyb ultrasensitive hybridization buffer (Invitrogen), followed by incubation at 72°C for 16 h. The membranes were washed as directed using a NorthernMax kit, with the two high-stringency washes performed at 68°C. RNA was visualized with a chemiluminescent nucleic acid detection kit (Thermo Fisher) according to the manufacturer’s instructions.

Gardiner JH I.V., Komazin G., Matsuo M., Cole K., Götz F, & Meredith T.C. (2020). Lipoprotein N-Acylation in Staphylococcus aureus Is Catalyzed by a Two-Component Acyl Transferase System. mBio, 11(4), e01619-20.

+ Open protocol

+ Expand

Northern Blot Analysis of HEK293 Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Northern blot hybridizations were conducted with the NorthernMax™ Kit (AM1940, Ambion, Austin, TX, USA) as previously described [57 (link)]. In brief, 15 µg total RNA from HEK293 cells were separated on 5% Criterion™ TBE polyacrylamide gels (3450048, Bio-Rad, Hercules, CA, USA) and transferred to positively charged nylon membranes (AM10100, Ambion, Austin, TX, USA). Hybridization was performed with a 5′ P³²-labeled DNA oligonucleotide overnight at 42 °C (NB-R1: 5′ CCCACCATGAGTCCAATGATTGCACCTTTGTTTGAACCCACATCTTCTGCAAAGAACACC 3′). Membranes were washed at 42 °C according the manufacturer’s recommendations (see NorthernMax™ Kit (AM1940, Ambion, Austin, TX, USA) for details). For RNase R treatment, 15 µg total RNA were digested with 10 units of RNase R (RNR07250, Epicentre, Madison, WI, USA) for 1 h at 37 °C; RNAs were separated by gel electrophoresis and analyzed by Northern blot hybridization as described above.

Mo D., Li X., Raabe C.A., Rozhdestvensky T.S., Skryabin B.V, & Brosius J. (2020). Circular RNA Encoded Amyloid Beta peptides—A Novel Putative Player in Alzheimer’s Disease. Cells, 9(10), 2196.

+ Open protocol

+ Expand

Quantitative Fluorescent Western Blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cost was calculated for NorthernMax Kit (Life technologies) for the blotting which uses 5×5 cm membrane with 1000 cm² of membrane sold for $469. Only kit and membrane cost $11.7 per blot. DFHBI-1T can be purchased from Lucerna technologies (New York) for $399.99 per 5 mg. 15 ml of 10 μM DFHBI-1T solution can be used for up to five stainings. This makes the cost ~$0.80 per gel.

Filonov G.S., Kam C.W., Song W, & Jaffrey S.R. (2015). In-gel imaging of RNA processing using Broccoli reveals optimal aptamer expression strategies. Chemistry & biology, 22(5), 649-660.

+ Open protocol

+ Expand

Quantification of circularβ-catenin by Northern Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

Digoxin-labeled RNA probe targeting the exon region shared by circβ-catenin and β-catenin was prepared with DIG Northern Starter Kit (Roche, USA). The target sequence of the RNA probe is 5′-GACACGCTATCATGCGTTCTCCTCAGATGGTGTCTGCTATTGTACGTACC-3′. Northern blotting assay was conducted by using Northern Max Kit from Ambion (Life Technologies) by following the manufacturer’s instructions. Electrophoresis of 15 μg total RNA was carried out on a 2% agarose gel and transferred to a Hybond-N⁺ membrane (GE Healthcare). Membranes were subsequently dried and crosslinked by ultraviolet. Pre-hybridization was performed at 62 °C for 2 h, and hybridization was performed at 62 °C for 16 h. The membrane was washed by SSC buffer with 0.1% SDS at 62 °C. After washing, the blots were visualized by the Typhoon scanner (GE Healthcare).

Liang W.C., Wong C.W., Liang P.P., Shi M., Cao Y., Rao S.T., Tsui S.K., Waye M.M., Zhang Q., Fu W.M, & Zhang J.F. (2019). Translation of the circular RNA circβ-catenin promotes liver cancer cell growth through activation of the Wnt pathway. Genome Biology, 20, 84.

+ Open protocol

+ Expand

Comprehensive RNA Extraction and Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from frozen cell pellets using the Qiagen RNeasy kit following the instructions, except that after resuspending in QIAzol lysis reagent, cells were subjected to bead beating. Bead beating was performed with 1.0-mm-diameter zirconia/silica beads (BioSpec) four times, 1 min each time, with 2-min pauses on ice. On-column DNase I digestion was performed to remove residual genomic DNA. RNA purity and concentration were estimated by Nanodrop. For qPCR, 1 µg of total RNA was converted to cDNA using the high-capacity RNA to cDNA kit (Applied Biosystems). A 1:100 dilution of cDNA was then subjected to real-time PCR with genomic DNA standards using Fast SYBR Green master mix (Applied Biosystems).
To estimate rDNA copy number, a 1:100 dilution of ChIP input DNA was used against genomic DNA standards to do qPCR. All qPCR quantitation was done using the absolute (standard curve) method.
Northern blotting was performed using a NorthernMax kit (Life Technologies). Briefly, 10 µg of total RNA was subjected to polyA selection using the Dynabeads mRNA Direct kit (Ambion) and loaded on a 1% formaldehyde agarose gel, blotted on a positively charged nylon membrane (Hybond N⁺, GE Healthcare), UV cross-linked, and then probed with radiolabeled PCR products designed against the 5′ end of STE11 and the 3′ end of STE11 and ACT1.

Sen P., Dang W., Donahue G., Dai J., Dorsey J., Cao X., Liu W., Cao K., Perry R., Lee J.Y., Wasko B.M., Carr D.T., He C., Robison B., Wagner J., Gregory B.D., Kaeberlein M., Kennedy B.K., Boeke J.D, & Berger S.L. (2015). H3K36 methylation promotes longevity by enhancing transcriptional fidelity. Genes & Development, 29(13), 1362-1376.

+ Open protocol

+ Expand

Analysis of miRNA Expression by Northern Blot

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from cells treated with normoxia and hypoxia were subjected to Northern blot analysis using non-radioactive biotin-probe method^{44 (link)}. Briefly, Total RNA from A2780 cells exposed to normoxia and hypoxia was loaded onto 15% Urea gel, electrophoresed and transferred to nylon membranes at 10–15 V (90 min) using Trans-Blot SD Semi-Dry Transfer Cell (Bio-Rad, CA). RNA was cross-linked to the membrane using UV cross linker. For miRNA and U6 probes, pre-synthesized LNA-modified oligonucleotides were purchased from Exiqon (http://www.exiqon.com) with biotin conjugation. Hybridization and washing of the membranes were carried out using Northern max kit (Life Technologies, CA) according to the manufacturer recommended protocol. Membranes were developed using Chemiluminescent Nucleic Acid Detection Module (Pierce Biotechnology, IL).

Rupaimoole R., Wu S.Y., Pradeep S., Ivan C., Pecot C.V., Gharpure K.M., Nagaraja A.S., Armaiz-Pena G.N., McGuire M., Zand B., Dalton H.J., Filant J., Miller J.B., Lu C., Sadaoui N.C., Mangala L.S., Taylor M., van den Beucken T., Koch E., Rodriguez-Aguayo C., Huang L., Bar-Eli M., Wouters B.G., Radovich M., Ivan M., Calin G.A., Zhang W., Lopez-Berestein G, & Sood A.K. (2014). Hypoxia Mediated Downregulation of miRNA Biogenesis Promotes Tumor Progression. Nature communications, 5, 5202.

+ Open protocol

+ Expand

Northern and Western Blotting of MEG3 and p53

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Northern blotting, total RNAs were isolated using TRIzol reagent according to the manufacture's instruction (Life Technology). Northern blotting was performed to detect MEG3 transcripts using the NorthernMax kit from Life Technology. Ten µg total RNA for each sample was loaded with dye containing ethidium bromide on 1.5% agarose gel. After electrophoresis, resolved RNAs were transferred to a Nytran membrane using a TurboBlotter from GE Healthcare (Pittsburgh, PA). The membrane was hybridized with MEG3 cDNA probe labeled with [α-³²P]dCTP using the Ready-To-Go DNA Labeling Beads from GE Healthcare. After washing, the membrane was exposed to a storage phosphor screen and analyzed by GE Storm 860 phosphor imager. The membrane was then stripped and re-probed to detect GAPDH as the internal control.
For Western blotting, total protein was isolated by lysis of cells with RIPA buffer containing protease inhibitor cocktail from Sigma Aldrich (P8340). Ten µg of total protein was resolved by 10% SDS-PAGE. After transfer to a PVDF membrane, the blot was probed with anti-p53 (FL393, Santa Cruz Biotechnology, Santa Cruz, CA) or anti-β-actin antibody (C4, Santa Cruz Biotechnology). P53 and β-actin were detected using Pierce ECL Plus Western blotting substrate (LifeTechnology) on a C-DiGit blot scanner (LI-COR Biotechnology, Lincoln, NE).

Chunharojrith P., Nakayama Y., Jiang X., Kery R.E., Ma J., De La Hoz Ulloa C.S., Zhang X., Zhou Y, & Klibanski A. (2015). Tumor Suppression by MEG3 lncRNA in a Human Pituitary Tumor Derived Cell Line. Molecular and cellular endocrinology, 416, 27-35.

+ Open protocol

+ Expand

Transcriptional Analysis of R. cellulolyticum

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from R. cellulolyticum cultures on cellobiose in mid-log-phase, and genomic DNA was removed using RNase-Free DNase Set (Sangon, China). The RNA quality was determined using a NanoVue Plus spectrophotometer (Biochrom, UK), and electrophoresis on 1% agarose-formaldehyde gels was performed.
Two micrograms of total RNA were electrophoresed on 1% agarose-formaldehyde gels and blotted onto a positively charged nylon membrane (GE HealthCare, USA) using the NorthernMax kit (Life Technologies, USA). DIG-labeled DNA probes for the detection of specific transcripts were generated with a DIG labeling and detection kit (Roche, Switzerland), as per the manufacturer’s instructions, using the oligonucleotides listed in Table S5.

Wu S., You M., Wang N., Ren Z, & Xu C. (2022). Internal Transcription Terminators Control Stoichiometry of ABC Transporters in Cellulolytic Clostridia. Microbiology Spectrum, 10(2), e01656-21.

+ Open protocol

+ Expand

RNA Isolation and Northern Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two micrograms of total RNA were isolated from bacterial cultures on cellobiose. The sample was analysed via electrophoreses on 1% agarose-formaldehyde gel and blotted onto a positively charged nylon membrane (Roche) using NorthernMax kit (Life Technologies). DIG-labelled DNA probes for the detection of specific transcripts were generated with a DIG labelling and detection kit (Roche) as described by the manufacturer's instructions using the oligonucleotides listed in Supplementary Data 7.

Xu C., Huang R., Teng L., Jing X., Hu J., Cui G., Wang Y., Cui Q, & Xu J. (2015). Cellulosome stoichiometry in Clostridium cellulolyticum is regulated by selective RNA processing and stabilization. Nature Communications, 6, 6900.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!