P53 sirna
P53 siRNA is a small interfering RNA (siRNA) molecule designed to target the p53 gene. The p53 gene is a tumor suppressor gene that plays a crucial role in regulating cell growth and division. The P53 siRNA is a laboratory tool used to temporarily silence the expression of the p53 gene, allowing researchers to study its function and role in various biological processes.
Lab products found in correlation
12 protocols using p53 sirna
Transfection of hMSCs with p53 siRNA
p53 Knockdown Using siRNA
Evaluating miR-24 and p53 in Oxidative Stress
Silencing Key Regulators in Cells
Targeting p53, JNK1, and JNK2 in SK-Hep-1 Cells
Targeted Modulation of DAPK1 and p53 Pathways
Targeted Silencing of BTG2 and p53
Cell transfection was performed using Lipofectamine 3000 (Invitrogen Life
Technologies) according to the manufacturer's instructions.
Downregulation of NR4A3 and p53 in chondrocytes
Targeted Silencing of Key Regulators in Pancreatic Cancer
Knockdown of JMJD5, p53 and TIGAR in HEK293FT Cells
HEK293FT cells were co-transfected with pLVX shJMJD5 and two packaging plasmids (psPAX2 and pMD2.G) to produce lentiviruses. The shRNA sequences targeting JMJD5 were as follows: sense:GATCCGCCACTGAGCTCTTCTACGACTCGAGTCGTAGAAGAGCTCAGTGGTTTTTG, antisense:AATTCAAAAACCACTGAGCTCTTCTACGACTCGAGTCGTAGAAGAGCTCAGTGGCG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!