Total RNA was extracted using the mRNeasy kit (Qiagen) according to the manufacturer’s instructions and concentration was determined with the Nanodrop (Thermo Scientific). cDNA synthesis was performed using the iScript Advanced cDNA synthesis kit from BioRad. PCR mix contained 5 ng of cDNA, 2.5 µl SsoAdvanced SYBR qPCR supermix (Bio-Rad) and 0.25 µl forward and reverse primer (to a final concentration of 250 nM, IDT) and was analysed on the LC-480 device (Roche) for RT-qPCR cycling. Expression levels were normalized using expression data of 3 stable reference genes (18 s, HMBS, SDHA) and analysed using qBasePlus software (http://www.biogazelle.com ). Relative abundance of ODC1 transcripts (forward: GATGACTTTTGATAGTGAAGTTGAGTTGA; reverse: GGCACCGAATTTCACACTGA), CDKN1A transcripts (forward: CCTCATCCCGTGTTCTCCTTT; reverse: GTACCACCCAGCGGACAAGT), RRM2 transcripts (forward: AGGACATTCAGCACTGGGAA; reverse: CCATAGAAACAGCGGGCTTC were measured relative to 18s (forward: TTCGGAACTGAGGCCATGAT; reverse: TTTCGCTCTGGTCCGTCTTG), HMBS (forward: GGCAATGCGGCTGCAA; reverse: GGGTACCCACGCGAATCAC) and SDHA (forward: TGGGAACAAGAGGGCATCTG; reverse: CCACCACTGCATCAAATTCATG) reference transcripts.
Lc480 device
Manufactured by Roche
The LC480 device is a real-time PCR instrument designed for gene expression analysis and quantification. It features a compact design, intuitive software, and high-quality optics to deliver reliable and reproducible results. The core function of the LC480 is to amplify and detect nucleic acid sequences in a controlled thermal environment, enabling researchers to quantify target genes and monitor gene expression levels.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop, by Thermo Fisher Scientific (3 mentions)
Iscript advanced cdna synthesis kit, by Bio-Rad (3 mentions)
Ssoadvanced sybr qpcr supermix, by Bio-Rad (3 mentions)
Primescript rt kit, by Takara Bio (2 mentions)
Prism v7, by GraphPad (2 mentions)
Rneasy kit, by Qiagen (2 mentions)
Kapa sybr fast qpcr kit, by Roche (2 mentions)
Dntps mix, by Thermo Fisher Scientific (2 mentions)
Poly a, by GE Healthcare (2 mentions)
Mirneasy kit, by Qiagen (2 mentions)
Mrneasy kit, by Qiagen (1 mentions)
Buffer with mgcl2, by Roche (1 mentions)
Forward and reverse primer, by Integrated DNA Technologies (1 mentions)
8 protocols using lc480 device
1
Quantifying Transcriptional Response via RT-qPCR
2
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ground tissue powder for each sample was dissolved in Trizol reagent (10–50 mg tissue/ml Trizol) and RNA was extracted following manufacturer's instructions. RNA samples were subjected to an extra clean-up step and DNase treatment using Qiagen RNeasy kit as per manufacturer's instructions (Qiagen #74106, #79254). cDNA was generated using PrimeScript RT kit (Takara #RR037A). qPCR was run on a LC480 device (Roche) with the KAPA SYBR Fast qPCR kit (#KK4618). A qPCR mix containing 4 μl SYBR Mix 2×, 0.33 μl primer pair (stock of 10 μM each in water) and 3.17 μl ultrapure water was prepared and mixed with 0.5 μl cDNA solution. Primers were purchased from Microsynth (Balgach, Switzerland) and stored as pairs at 10 μM each. Samples were run in technical triplicates and GAPDH was used as housekeeping control. Fold change calculations for the FECH correctly spliced transcript were made by comparing each treatment group with the saline group. FECH FW primer: 5′-CCT ATT CAG AAT AAG CTG GCA CC-3′; FECH RV primer: 5′-GGG GAT CCG CCT CCA ATC-3′. GAPDH FW primer: 5′-AGG TCG GTG TGA ACG GAT TTG-3′; GAPDH RV primer: 5′-TGT AGA CCA TGT AGT TGA GGT CA-3′. Statistical analysis (multiple t-tests) and outlier removal (ROUT method) were conducted with GraphPad Prism v7. software.
3
Quantitative Analysis of Oligonucleotides in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ground tissue powder was suspended in 10 volumes/weight OTX Lysis Buffer, briefly needle-sonicated and centrifuged for 30 s at 14 000 rpm. Supernatants were collected, diluted at 1/750 in ultrapure water, and used for analysis. CL-qPCR was carried out following the protocol from Boos et al. (27 (link)), with minor modifications. For each tissue and each compound, a calibration curve was generated and run along with the samples. Mix composition for Chemical Ligation: 0.1 μl PS primer (10 μM stock), 0.1 μl BPS primer (10 μM primer), 1 μl Poly A (GE Healthcare #27411001, 1 mg/ml), 1 μl 10× Buffer with MgCl2 (Roche #12032902001) and 5.8 μl ultrapure water, mixed with 2 μl diluted lysate. Chemical ligation was run for 1 h at 33°C. qPCR was run on a LC480 device (Roche). A qPCR mix containing 0.15 μl FW primer (10 μM stock), 0.15 μl RV primer (10 μM stock), 0.13 μl BHQ primer (28.28 μM stock), 0.15 μl dNTPs mix (ThermoFisher #10297018), 1 μl 10× Buffer with MgCl2 (Roche #12032902001), 0.1 μl 10× FastTaq Polymerase (Roche #12032902001) and 6.32 μl ultrapure water was prepared and mixed with 2 μl of chemical ligation reaction mixture. qPCR program was as follows: 10 min, 95°C, 50 cycles (3 s/95°C – 30 s/55°C – 10 s/72°C). Concentrations in tissues were obtained through interpolation from the calibration curves and expressed in ng oligonucleotide/mg tissue for each mouse.
4
Quantifying miRNA Expression in Plasma sEVs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Considering that plasma samples contain low quantities of sEVs-miRNA, we used the one-step advanced miRNA system to simultaneously assess the expression levels of multiple miRNAs from the same sample. An amount of 4 μL of plasma sEVs RNAs or 10 ng of total RNA from biopsies were pre-amplified using universal RT miRNA primers to generate cDNAs following the TaqMan Advanced miRNA cDNA Synthesis Kit protocol. Next, 1:10 v/v diluted cDNAs and specific miRNA advanced assays were amplified with TaqMan Fast Advanced Master Mix (2X) using the LC480 device (Roche, Basel, Switzerland) with the following PCR settings: 55 °C for 2 min to remove RNA contaminants; 95 °C for 20 sec for Taq polymerase amplification; 40 cycles of 95 °C for 3 sec followed by 60 °C for 30 sec for PCR amplification. The efficiency of qPCR amplification was evaluated using the standard curve generated for cel-miR-39 exogenous normalizer, started with 2 × 108 transcripts. ∆∆Ct method was used for miRNA relative quantification by reporting the Ct values of the miRNAs of interest to miR-16-5p Ct values. For the sEVs samples, all Ct values were beforehand normalized to cel-miR-39 expression.
5
RT-qPCR Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using miRNeasy kit (Qiagen) according to the manufacturer’s instructions, including on-column DNase treatment, and concentration was determined with the Nanodrop (Thermo Scientific). cDNA synthesis was performed using the iScript Advanced cDNA synthesis kit from BioRad. PCR mix contained 5 ng of cDNA, 2.5 ul SsoAdvanced SYBR qPCR supermix (Bio-Rad) and 0.25 µl forward and reverse primer (to a final concentration of 250 nM, IDT) and was analysed on the LC-480 device (Roche) for RT-qPCR cycling. Expression levels were normalized using expression data of 3 stable reference genes out of 5 reference genes tested (SDHA, YWHAZ, TBP, B2M, HPRT1) and analyzed using qBasePlus software (http://www.biogazelle.com ). All primer pair sequences can be found in Supplementary Table 2 .
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed, practicing the manufacturer’s instructions of miRNeasy kit (QIAGEN) including on-column deoxyribonuclease treatment, and NanoDrop (Thermo Fisher Scientific) was used to determine the concentration. Complementary DNA (cDNA) synthesis was achieved, practicing the iScript Advanced cDNA synthesis kit instructions from Bio-Rad. The PCR mix contained 5 ng of cDNA, 2.5 μl of SsoAdvanced SYBR qPCR super mix (Bio-Rad), and 0.25 μl of forward and reverse primers (to a final concentration of 250 nM; Integrated DNA Technologies). The RT-qPCR cycling analysis was performed using a LC-480 device (Roche). qBasePlus software 3.2 (www.biogazelle.com ) was used for the analysis of the gene expression levels. For the neuroblastoma cell lines, the following reference genes were used: B2M, HPRT1, TBP, and YHWAZ. The error bars in figures represent SD after error propagation, with mean centering and scaling to control. The primer designs are provided on table S6.
7
Quantification of Oligonucleotides in Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ground tissue powder was suspended in 10 volumes/weight OTX Lysis Buffer, briefly needlesonicated and centrifuged for 30 s at 14'000 rpm. Supernatants were collected, diluted at 1/750 in ultrapure water, and used for analysis. CL-qPCR was carried out following the protocol from Boos et al. (28) , with minor modifications. For each tissue and each compound, a calibration curve was generated and run along with the samples. Mix composition for Chemical Ligation: 0.1 µl PS primer (10 µM stock), 0.1 µl BPS primer (10 µM primer), 1 µl Poly A (GE Healthcare #27411001, 1 mg/ml), 1 µl 10X Buffer with MgCl2 (Roche #12032902001) and 5.8 µl ultrapure water, mixed with 2 µl diluted lysate.
Chemical ligation was run for 1 h at 33°C. qPCR was run on a LC480 device (Roche). A qPCR mix containing 0.15 µl FW primer (10 µM stock), 0.15 µl RV primer (10 µM stock), 0.13 µl BHQ primer (28.28 µM stock), 0.15 µl dNTPs mix (ThermoFisher #10297018), 1 µl 10X Buffer with MgCl2 (Roche #12032902001), 0.1 µl 10X FastTaq Polymerase (Roche #12032902001) and 6.32 µl ultrapure water was prepared and mixed with 2 µl of chemical ligation reaction mixture. qPCR program was as follows: 10 min, 95°C, 50 cycles (3 s/95°C -30 s/55°C -10 s/72°C). Concentrations in tissues were obtained through interpolation from the calibration curves and expressed in ng oligonucleotide / mg tissue for each mouse.
Chemical ligation was run for 1 h at 33°C. qPCR was run on a LC480 device (Roche). A qPCR mix containing 0.15 µl FW primer (10 µM stock), 0.15 µl RV primer (10 µM stock), 0.13 µl BHQ primer (28.28 µM stock), 0.15 µl dNTPs mix (ThermoFisher #10297018), 1 µl 10X Buffer with MgCl2 (Roche #12032902001), 0.1 µl 10X FastTaq Polymerase (Roche #12032902001) and 6.32 µl ultrapure water was prepared and mixed with 2 µl of chemical ligation reaction mixture. qPCR program was as follows: 10 min, 95°C, 50 cycles (3 s/95°C -30 s/55°C -10 s/72°C). Concentrations in tissues were obtained through interpolation from the calibration curves and expressed in ng oligonucleotide / mg tissue for each mouse.
8
qPCR Analysis of FECH Transcript
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ground tissue powder for each sample was dissolved in Trizol reagent (10 to 50 mg tissue/ml Trizol) and RNA was extracted following manufacturer's instructions. RNA samples were subjected to an extra clean-up step and DNase treatment using Qiagen RNeasy kit as per manufacturer's instructions (Qiagen #74106, #79254). cDNA was generated using PrimeScript RT kit (Takara #RR037A). qPCR was run on a LC480 device (Roche) with the KAPA SYBR Fast qPCR kit (#KK4618). A qPCR mix containing 4 µl SYBR Mix 2X, 0.33 µl primer pair (stock of 10 µM each in water) and 3.17 µl ultrapure water was prepared and mixed with 0.5 µl cDNA solution. Primers were purchased from Microsynth (Balgach, Switzerland) and stored as pairs at 10 µM each. Samples were run in technical triplicates and GAPDH was used as housekeeping control. Fold change calculations for the FECH correctly spliced transcript were made by comparing each treatment group with the saline group. FECH FW primer: 5'-CCTATTCAGAATAAGCTGGCACC-3'; FECH RV primer: 5'-GGG GAT CCG CCT CCA ATC-3'. GAPDH FW primer: 5'-AGG TCG GTG TGA ACG GAT TTG -3'; GAPDH RV primer: 5'-TGT AGA CCA TGT AGT TGA GGT CA-3'. Statistical analysis (multiple t-tests) and outlier removal (ROUT method) were conducted with GraphPad Prism v7. software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!