Pmir report luciferase vector

The 3′UTR of EZH2 was amplified by PCR from genomic DNA of HEK293T cells with the following primers: Forward: 5′ AGGTCTAGACCTCTGAAACAGCTGCCTTA 3′ and Reverse: 5′ CCTGAGCTCGCATTATTGCAAAAATTCAC 3′. The 3′UTR was cloned downstream of the luciferase coding sequence in the pMIR-REPORT Luciferase vector (Promega). The construct was confirmed by sequencing. Hsa-miR-138 mimics and none-target control were purchased from GenePharma. And the sequence are as follows: Hsa-miR-138 mimics, Forward: 5′AGCUGGUGUUGUGAAUCAGGCCG 3′and Reverse: 5′GCCUGAUUCACAACACCAGCUUU 3′; none-target control, Forward: 5′ UUCUCCGAACGUGUCACGUTT 3′and Reverse: 5′ ACGUGACACGUUCGGAGAATT 3′.
HEK293T cells were plated in 24-well dishes overnight before transfection. Hsa-miR-138 mimics or none-target control was transfected into HEK293T cells as well as 200 ng of pMIR-REPORT-EZH2 and 20 ng of pRL-renilla by lipofectmine 2000 (Invitrogen). Medium was changed 6 h later. After 48 h, luciferase assay was performed with dual-luciferase reporter assay systems (Promega) according to the manufacturer’s instructions. Measurements were carried out in triplicates and expressed as mean ± SD. Three independent transfection experiments were performed.

The 5′UTR (untranslational region), CR (coding region), and 3′UTR fragments of IL6 mRNA was generated by PCR and inserted into the pMIR-REPORT™ Luciferase vector (Promega, Madison, WI) just after the stop codon. The transfection was carried out with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Cells were incubated for 48 h and harvested by adding 100 μl of reporter lysis buffer (Dual-Luciferase Assay System, Promega). The firefly and Renilla luciferase activities were then measured using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI) and a luminometer (Mannedorf, Switzerland). Firefly luciferase (FFL) activities were normalized by Renilla (RL) activities yielding relative activities (RLU). All experiments were done in triplicate and independently performed at least three times to confirm the results. The mean ± SD calculated from one representative experiment was presented.

Cells seeded in 12-well plates were cotransfected with 200 ng pcDNA3.1- ALKBH5-WT/H204A, 20 ng pRL-TK (Renilla luciferase control reporter vector) and 300 ng pMIR-Report luciferase vector (Promega) fused with the wild-type EIF4EBP1-3’UTR and MLST8-3’UTR. 24 h after transfection, cells were treated with BP for a period of 24 h. Then, the relative luciferase activities were calculated using a Dual-luciferase Reporter Assay System (Promega). Each experiment was repeated in trice.

By using the online tools of microcosm (http://mirecords.biolead.org) and dreamBase (http://rna.sysu.edu.cn/dreamBase/), miR-145-5p was respectively predicted directly binding to the sequences of either the 3’-untranslated region (3’-UTR) of RGS3 mRNA or the UBE2MP1 transcript. Both of the sequences above were intercepted for the 202 bp sections along with the corresponding mutative ones for further detection by the dual-luciferase reporter assay. (Supplementary Table 2). The sequences were respectively cloned into the pMIR-Report luciferase vector, which contains firefly luciferase, and the pRL-TK vector luciferase was set as control (Promega, Madison, WI, USA). These two sets of vectors were co-transfected into both HepG2 and Hep3B cells transfected miR-145a-5p mimics or the control ones. The luciferase activity was measured via the Dual-Glo Luciferase assay system (Promega) 48 hours after the transfection.