Log In Sign up
The largest database of trusted experimental protocols

Glomax multi detection plate reader

Manufactured by Promega
Visit Supplier
Sourced in Switzerland

The GloMax Multi Detection Plate Reader is a versatile instrument designed to measure various luminescent, fluorescent, and absorbance-based assays. It is capable of detecting and quantifying a wide range of biomolecules and cellular activities in microplate format.

Automatically generated - may contain errors

Lab products found in correlation

Dual luciferase reporter assay system, by Promega (2 mentions) 96 well plate, by Greiner (2 mentions) Celltiter blue viability stain, by Promega (2 mentions) Spark 10m plate reader, by Tecan (1 mentions) Phorbol myristate acetate (pma), by Merck Group (1 mentions) Tunicamycin, by Merck Group (1 mentions) Bright glo luciferase assay kit, by Promega (1 mentions) Tnf α, by R&D Systems (1 mentions) Celltiter glo kit, by Promega (1 mentions) Prism 6, by GraphPad (1 mentions) Calf intestinal alkaline phosphatase, by Promega (1 mentions) Luciferase assay system, by Promega (1 mentions) Dmem f12, by Thermo Fisher Scientific (1 mentions) Bradford assay, by Bio-Rad (1 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions) Human il 23 elisa kit, by Thermo Fisher Scientific (1 mentions) Celltiter glo luminescent cell viability, by Promega (1 mentions) Quick cell proliferation colorimetric assay kit, by Abcam (1 mentions) Z2 coulter counter, by Beckman Coulter (1 mentions) Nano glo luciferase assay system, by Promega (1 mentions)

Spelling variants of this product

GloMax (528 citations) GloMax plate reader (197 citations) GloMax-Multi (71 citations) GloMax-Multi plate reader (27 citations) GloMax®-Multi Detection System plate reader (19 citations) GloMax Multi Reader (9 citations) GloMax Multi Detection reader (3 citations)

17 protocols using glomax multi detection plate reader

1

Quantifying STAT3 DNA Binding in MM Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The DNA binding capacity of STAT3 was determined in MM cell nuclear extracts using the TransAM® STAT3 DNA-binding kit (Active Motif 45,196 and 40,010) according to the suppliers’ instructions. Resultant absorbance at 450 nm that correlates with STAT binding to a consensus DNA sequence was read using the Promega Glomax Multi Detection Plate Reader (Promega). STAT3-luciferase reporters based on IL-6 sis-Inducible Element (SIE). Briefly, 293 T cells were transfected in six-well plates using PEI Max polyethylenimine (Polysiciences 75,800–188). The plasmids co-transfected for STAT3 reporter activity and for transfection normalization were pGL4.47[luc2P/SIE/Hygro] and pGL3-Ren-Luc (Promega), respectively, at 5:1 ratio. After 16 h, cells were replated in 96-well plates for 24 h. STAT3 reporter cells were pretreated with compounds for 1 h including vehicle, BAY, AZD, AQ, then stimulated with IL-6 (10 ng/mL) for 5 h. Firefly and renilla luciferase activities were measured following manufacturer's instructions (Dual-Luciferase Reporter Assay System, Promega PAE1910) using the Promega Glomax Multi Detection Plate Reader (Promega).
Li L., Hu X., Nkwocha J., Sharma K., Kmieciak M., Mann H., Zhou L, & Grant S. (2023). Non-canonical role for the ataxia-telangiectasia-Rad3 pathway in STAT3 activation in human multiple myeloma cells. Cellular Oncology (Dordrecht), 46(5), 1369-1380.
+ Open protocol
+ Expand
2

Transcriptional Regulation by DNAJB3 in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK-293 and C2C12 were transfected with 5 µg of the reporter plasmid and 10 µg of either pCMV-DNAJB3 or pCMV and then, plated on 96-well plates at 1.104 cells/well followed by a 24-h incubation. Cells were then treated with 25 ng/ml of TNF-α (R&D Systems, Minneapolis, MN) or 5 µM PMA (Sigma Aldrich, St. Louis, MO) or 0.5 μg/ml Tunicamycin (Sigma Aldrich, St. Louis, MO) for 16 h and afterwards, harvested for luciferase assays using the Bright Glo Luciferase Assay kit (Promega, Madison, WI). Luciferase activity was measured either on Spark® 10 M plate reader (Tecan, Männedorf, Switzerland) or Glomax multi detection plate reader (Promega, Madison, WI). Differences in transfection efficiency were normalized with pRL-CMV internal control.
Arredouani A., Diane A., Khattab N., Bensmail I., Aoude I., Chikri M., Mohammad R., Abou-Samra A.B, & Dehbi M. (2019). DNAJB3 attenuates metabolic stress and promotes glucose uptake by eliciting Glut4 translocation. Scientific Reports, 9, 4772.
+ Open protocol
+ Expand
3

Pyrazole Derivatives Cytotoxicity in Vero Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Vero cells were used as a cellular model to analyze the toxic effect of pyrazole derivatives, series 1(a–l), 2(a–l), 3(a–n), 4(a–c), and 5(a–c), and Benznidazole (Bz) on mammalian cells. Briefly, the cells, plated on 96-well white opaque microplate (1.5 × 104 cells/well), were treated for 72 h at 37 °C with a wide range concentration (500–1.95 µM) of the pyrazole derivatives [13 (link)]. The cell viability was determined by measuring ATP levels using the CellTiter Glo Kit (Promega Corporation, Madison, WI, EUA) followed by reading the luminescent signal on the Glomax-Multi Detection plate reader (Promega Corporation, Madison, WI, EUA)). All treatments and controls were performed at a low concentration of DMSO (≤1%). The 50% cytotoxic concentration values (CC50; the concentration of the compound that reduces 50% of the cell viability) were estimated by linear regression analysis. Three independent assays were performed in duplicate.
Orlando L.M., Lechuga G.C., da Silva Lara L., Ferreira B.S., Pereira C.N., Silva R.C., dos Santos M.S, & Pereira M.C. (2021). Structural Optimization and Biological Activity of Pyrazole Derivatives: Virtual Computational Analysis, Recovery Assay and 3D Culture Model as Potential Predictive Tools of Effectiveness against Trypanosoma cruzi. Molecules, 26(21), 6742.
+ Open protocol
+ Expand
4

EFQO Assay for 5' Exonuclease Activity

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The EFQO assay was performed as previously described in ref. 29 (link). Briefly, the assay uses fluorophore- and fluorescence-quencher-labeled oligonucleotides to assess the 5’ exonuclease activity at a pH of 5 (MES buffer). Used sequences with varying degrees of CpG-content include random reference sequence (/56-FAM/accatgatgttcctgatgctaagtatg*c*a*c*/3IABkFQ/, /56-FAM/accatgacgttcctgatgctaagtatg*c*a*c*/3IABkFQ/ and /56-FAM/accatgacgttcctgacgctaagtacg*c*a*c*/3IABkFQ/), the MT-ATP6 gene (/56-FAM/agccctggctgtatgcctaactgctaa*c*a*t*/3IABkFQ/, /56-FAM/agccctggccgtacgcctaaccgctaa*c*a*t*/3IABkFQ/ and /56-FAM/agccctggccgtatgcctaactgctaa*c*a*t*/3IABkFQ/) and the MT-ND4L gene (/56-FAM/agtctttgctgcctgtgaagcagtggt*g*g*g*/3IABkFQ/, /56-FAM/agtctttgccgcctgcgaagcagcggt*g*g*g*/3IABkFQ/, and /56-FAM/agtctttgctgcctgtgaagcagcggt*g*g*g*/3IABkFQ/). The * indicates a PTO bond, excluding 3’−5’ exonuclease activity. As 5’-Mod we used 6-Fam (qPCR probe) and at the 3’ end the Iowa Black FQ. Oligos were ordered from IDT. Fluorescent signals were acquired for a 12 h time-frame with 5 min intervals on a GloMax Multi Detection Plate Reader (Promega).
Van Acker Z.P., Perdok A., Hellemans R., North K., Vorsters I., Cappel C., Dehairs J., Swinnen J.V., Sannerud R., Bretou M., Damme M, & Annaert W. (2023). Phospholipase D3 degrades mitochondrial DNA to regulate nucleotide signaling and APP metabolism. Nature Communications, 14, 2847.
+ Open protocol
+ Expand
5

Enzyme Kinetics of Glycosyltransferase Fut8

Check if the same lab product or an alternative is used in the 5 most similar protocols
The relative enzyme activity of the substrates, A2-Asn, A2Asn-Fmoc, GlcNAc1Man5GlcNAc2-Asn, GlcNAc1Man5GlcNAc2-Asn-Fmoc, Man5GlcNAc2-Asn and Man5GlcNAc2-Asn-Fmoc, were determined by titrating with wild type Fut8 enzyme purified as reported earlier (27 ). Enzyme kinetics were performed using GDP-Glo™ Glycosyltransferase assay (Promega) for the substrates at a concentration range of 0–1mM (0–1.5 mM for Man5GlcNAc2-Asn) along with GDP-fucose (0.2 mM final concentration, pre-treated with Calf Intestinal alkaline-phosphatase (Promega)) as donor sugar (27 ). Reactions were carried out in a 10 μl reaction volume consisting of a universal buffer (200 mM each of Tris, MES, MOPS, pH 7.5) with the purified wild type enzyme at 37°C for 30 min. Reactions were stopped using 5 μl of GDP detection reagent and an equal volume of reaction mix in a polystyrene, white 384-well plate and incubating in dark for 1 h at room temperature. The luminescence values were measured using a GloMax Multi detection plate reader (Promega) and compared with a GDP standard curve to quantify the final released GDP product. The steady state parameters of KM, kcat, and kcat/KM values were determined using nonlinear curve fitting in GraphPad Prism 6 software.
Zhang R., Yang Q., Boruah B.M., Zong G., Li C., Chapla D., Yang J.Y., Moremen K.W, & Wang L.X. (2021). Appropriate aglycone modification significantly expands the glycan substrate acceptability of α1,6-fucosyltransferase (FUT8). The Biochemical journal, 478(8), 1571-1583.
+ Open protocol
+ Expand
6

Neuroprotective Modulation of Amyloid-β Toxicity

Check if the same lab product or an alternative is used in the 5 most similar protocols
Paraquat dichloride (Methyl viologen dichloride hydrate, PQ), amyloid-ß protein fragment 1–42 (Aβ1-42), tert-butylhydroquinone 97% (tBHQ), benfotiamine (S-benzoylthiamine O-monophosphate, BFT), pyrithiamine hydrobromide and thiochrome were from Sigma-Aldrich BVBA (Overijse, Belgium). Luciferase Assay System was from Promega Benelux BV (Leiden, The Netherlands) and luminescence was detected in 96-well plates using a Promega GloMax-Multi Detection plate reader. Sulbutiamine (SuBT) was from Mind Nutrition (https://mindnutrition.com).
Sambon M., Napp A., Demelenne A., Vignisse J., Wins P., Fillet M, & Bettendorff L. (2019). Thiamine and benfotiamine protect neuroblastoma cells against paraquat and β-amyloid toxicity by a coenzyme-independent mechanism. Heliyon, 5(5), e01710.
+ Open protocol
+ Expand
7

Culturing and Lysis of SH-SY5Y Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human SH-SY5Y neuroblastoma cells were cultured in DMEM/F-12 (Gibco) supplemented with 10% (v/v) fetal bovine serum (Gibco), 100 units/mL of penicillin, and 100 μg/mL of streptomycin. Cells maintained under standard conditions (37°C, 5% CO2) and split every 4–5 days. For the lysis, cells were pelleted and incubated with 1% Triton X-100 in PBS for 30 min at 4°C. After a centrifugation step (5 min at 13000 g), protein concentration on the supernatant was quantified by Bradford assay (BioRad) in a GloMax Multi Detection Plate Reader (Promega).
Bademosi A.T., Decet M., Kuenen S., Calatayud C., Swerts J., Gallego S.F., Schoovaerts N., Karamanou S., Louros N., Martin E., Sibarita J.B., Vints K., Gounko N.V., Meunier F.A., Economou A., Versées W., Rousseau F., Schymkowitz J., Soukup S.F, & Verstreken P. (2023). EndophilinA-dependent coupling between activity-induced calcium influx and synaptic autophagy is disrupted by a Parkinson-risk mutation. Neuron, 111(9), 1402-1422.e13.
+ Open protocol
+ Expand
8

IL-15 Modulates Monocyte-Derived DC Cytokine

Check if the same lab product or an alternative is used in the 5 most similar protocols
An equal number of monocyte-derived DCs (either long-term IL-15-exposed or controls) was matured in the presence of PGN, curdlan along with or without IL-15 for 24 hours in complete medium in triplicate or quadruplicate wells. For immature condition, DCs were cultured in complete medium alone. Supernatants were taken and directly used for ELISA without dilution. Similarly, for short term IL-15 exposure, IL-15 was added to DC cultures during only maturation with PGN or curdlan for 24 hours, and the supernatants were collected and used for ELISA without dilution. Human IL-23 ELISA kit was purchased from eBioscience (#BMS2023-3). ELISA protocol was performed in accord with the manufacturer’s guidelines. The plates were read on the Promega Glomax Multi Detection plate reader.
Eken A., Okus Z., Erdem S., Azizoglu Z.B., Haliloglu Y., Bicer A., Gur T.N., Yilmaz E., Karakukcu M., Altuntas H.D, & Canatan H. (2019). IL-15 negatively regulates curdlan-induced IL-23 production by human monocyte-derived dendritic cells and subsequent Th17 response. Northern Clinics of Istanbul, 6(4), 379-387.
+ Open protocol
+ Expand
9

Cell Proliferation Assay for DNA Damage

Check if the same lab product or an alternative is used in the 5 most similar protocols
5000 BT549 or 6000 MDA-MB-231 cells were seeded into 96 well plates and treated with various DNA damaging agents or vehicle controls. Cell growth was quantified using the CellTiter-Glo® Luminescent Cell Viability (Promega G7572) or Quick Cell Proliferation Colorimetric Assay Kit (BioVision #K302-2500) according to the manufacturer's instructions. Luminescence or absorbance (450 nm) was measured with the GloMax Multi Detection Plate Reader (Promega).
Liu Q., Chung S., Murata M.M., Han B., Gao B., Zhang M., Lee T.Y., Chirshev E., Unternaehrer J., Tanaka H., Giuliano A.E., Cui Y, & Cui X. (2022). TOP1 inhibition induces bifurcated JNK/MYC signaling that dictates cancer cell sensitivity. International Journal of Biological Sciences, 18(10), 4203-4218.
+ Open protocol
+ Expand
10

Dual Luciferase Reporter Assay in RRL

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pure dual LUC reporter RNAs were incubated in RRL (Promega, Madison, WI) supplemented with 150 mM potassium acetate (final concentration) and amino acids for 90 min at 30°C. LUC production was measured using the Dual Luciferase Reporter Assay System (Promega) and the GloMax Multi Detection plate reader. Data shown are from five independent experiments.
Ruehle M.D., Zhang H., Sheridan R.M., Mitra S., Chen Y., Gonzalez RL J.r., Cooperman B.S, & Kieft J.S. (2015). A dynamic RNA loop in an IRES affects multiple steps of elongation factor-mediated translation initiation. eLife, 4, e08146.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!