Lightcycler 480 high resolution melting master mix

Total RNA from heading and non-heading leaves of B. oleracea var. capitata (cabbage) were isolated using TransZol (TRAN, Beijing, China). Reverse transcription was performed using a HiScript II Q RT SuperMix for qPCR (+gDNA wiper) kit (Vazyme, Nanjing, China). qRT-PCR was performed using LightCycler 480 High-Resolution Melting Master Mix (Roche, Switzerland) following the manufacturers’ instructions on a Roche LC 480 machine. Relative gene expression levels were calculated using the 2^−∆∆Ct method [73 (link)]. The primer pairs used in the qPCR experiment are shown in Supplementary Table S10.

HRM analysis was performed on CRLF2 (exon 6) and JAK2 (exon 16) hotspots. All samples were tested in duplicate, positive and negative controls for each exon were included in each run. PCR was carried out using 40 ng of genomic DNA, 0.3 µM of each primer (Supplementary Table S3), 3 mM of MgCl₂, and 1X LightCycler 480 High Resolution Melting Master Mix (Roche). Melting curves were analyzed using Gene Scanning software (Roche). All samples showing divergent melting curves were sequenced following standard protocols on a SeqStudio Genetic Analyzer (Applied Biosystems, Foster City, CA).

The RNA yield was assessed by means of NanoDrop and the 2100 Bioanalyzer in combination with the RNA 6000 Nano kit (Agilent) and by means of RT-qPCR for the ACTB gene.
For RT-qPCR, cDNA was prepared by adding 5 μl of RNA extract to a final volume of 20 μl of the RevertAid RT Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Two μl of the cDNA was subsequently added to a total reaction volume of 10 μl PCR mix, consisting of 0.5 μM of each β-actin primer [21 (link)], 2 mM of MgCl₂ and LightCycler 480 High Resolution Melting Master Mix (Roche Applied Sciences, Indianapolis, IN, USA). Amplification was carried out on a LightCycler 480 (Roche) using the following program: pre-incubation for 30 s at 95 °C and amplification for 45 cycles of 30 s at 95 °C, 10 s at 56 °C and 30 s at 72 °C, after which a high resolution melting curve was generated, using the following protocol: 5 s at 95 °C, 1 min at 58 °C, followed by a gradual increase in temperature from 60 °C to 97 °C, using a ramp rate of 0.02 °C per s. Results were analyzed with the standard LightCycler 480 Software, version 1.5 (Roche).

Amplicons resulting from the MIP capture protocol in Fig. 4 before NGS library preparation were used as templates and diluted 1:10,000 for high-resolution melt analysis. This was compared to concentrations of genomic DNA which were used as an input to the MIP protocol. HPLC purified primers for F. tularensis gyrA (forward 5′-CGGTAAATATCACCCTCATGGAG and reverse 5′- AGGTTGTGCCATTCTGACAATAGTAT) and parE (forward 5′-CTTACATGGCATTTTGAAACTGGAC and reverse 5′- CAGCTTCTAGTTTATGGTCAAGATAGCC) were utilized4 (link). Reaction conditions included 1X Lightcycler 480 High Resolution Melting Master Mix (Roche Diagnostics, Indianapolis, IN), 0.4 μM forward and reverse primers, and MgCl₂ to a final concentration of 3 mM. Reactions were performed on a Roche 480 Lightcycler (Roche Diagnostics, Indianapolis, IN) with thermocycling conditions consisting of a pre-incubation cycle of 95 °C for 10 min, a 45 cycle amplification step of 95 °C for 10 sec, 60 °C for 10 sec, and 72 °C for 10 sec with a fluorescence reading taken at the end of each 72 °C step, and a high-resolution melt step of 95 °C for 1 min, 45 °C for 1 min, and melt curve from 65 °C to 95 °C with 25 fluorescent readings taken per 1 °C temperature change. Values were generated using the melt curve genotyping analysis with the integrated Roche LightCycler 480 software version 1.5.1.

For samples from human or animal origin with a low DNA content (Cq higher than 33 with the C. psittaci real-time PCR), a pre-amplification step was done to increase the amount of DNA template (using the Perfecta^® pre-amplification kit (Quantabio) and a mix of the eight set of primers for 15 cycles).
PCR-HRM amplifications were performed on the ViiA7™ Real-Time PCR System (Life Technologies, Carlsbad, CA, USA) using the LightCycler^® 480 High Resolution Melting Master Mix (Roche Diagnostics, Roche, Switzerland). The reaction mixture consisted of 0.2 μM of each primer, 1 × LightCycler^® 480 HRM master mix and 2.5 mM MgCl2 in an 18-μL final volume. The following parameters were used: 10 min at 95 °C were followed by 40 cycles consisting of 10 s at 95 °C, 10 s at 60 °C and 20 s at 72 °C. Samples were next heated to 95 °C for 30 s, cooled down to 65 °C for 1 min and heated from 65 °C to 88 °C at a rate of 1 °C/s with 25 acquisitions/°C. HRM data were analyzed by the ViiA7™ Software (version 1.2.1). Synthetic oligonucleotide templates were PCR amplified and used as controls for each marker (dilution of 10⁻⁷ from a 100 µM solution) in HRM analysis.

DNA samples were isolated from G. parasuis clinical isolates using the TIANamp Bacteria DNA Kit (Tiangen, China) according to the manufacturer’s instructions. The HRM primers (P1, P2) were designed to amplify the sequences (approximately 100 bp) surrounding the target site. The annealing temperatures of the HRM primers were optimized to approximately 60°C and purified by HPLC.
A sample of 20 ng of the genomic DNA of a G. parasuis strain was used as a template in a 20 μl PCR reaction using a LightCycler® 480 High Resolution Melting Master kit (Roche), with 1× LightCycler® 480 High Resolution Melting Master Mix, and final concentrations of 200 nM of forward and reverse primers and 3 mM MgCl₂. A total of 108 bp PCR products surrounding the target site were amplified in the LightCycler® 96 instrument (Roche), using the following cycling conditions: pre-incubation 10 min 95°C, 45 cycles 3-step amplification (95°C for 10 s, 57°C for 10 s, 72°C for 20 s) followed by one cycle of high resolution melting [95°C for 60 s, 40°C for 60 s, 65°C for 1 s, and finally using a ramp rate 0.07°C/s and an acquisition mode setting of 15 readings/s to reach the target temperature 95°C (1 s)]. Raw data were analyzed using the LightCycler® 96 software 1.1 (Roche), which sorted the samples into groups based on their normalized melting curves. Each sample included 2–3 technical replicates.