Total RNA, including small RNAs and mRNA, was extracted using the TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instruction. The concentration of RNA was determined using a NanoDrop spectrophotometer (NanoDrop, USA). The miR-497 stem-loop primer, U6 primer, mRNA primer, and GAPDH primer were bought from Guangzhou RiboBio Co., LTD. The expression of miR-497 was assayed using stem-loop RT, followed by real-time PCR analysis. MiR-497 cDNA was synthesized from total RNA using the miRNA reverse transcription kit (TaKaRa, Dalian, China), and the expression levels of miR-497 were quantified using the miRNA-specific assay kit (TaKaRa, Dalian, China). U6 snRNA was used as an internal control. Reverse transcription of the mRNAs were performed using the PrimeScript RT reagent kit (TaKaRa, Dalian, China), and the expression levels of the mRNAs were determined using SYBR Premix Ex Taq (TaKaRa, Dalian, China), with GAPDH as an internal control. Real-time PCR was performed on a real-time PCR instrument (CFX96, BIORAD, USA). The results of the qRT-PCR analysis were determined based on the threshold cycle (Ct), and the relative expression levels were calculated using the 2-ΔΔCt method, after normalization to the expression of the internal control gene.
U6 primer
Manufactured by RiboBio
Sourced in China
U6 primers are a type of genetic sequencing primers used in molecular biology research. They are designed to target and amplify the U6 small nuclear RNA (snRNA) gene, which is a highly conserved and ubiquitously expressed non-coding RNA involved in the splicing of pre-mRNA. The U6 primers are commonly used in various applications, such as gene expression analysis, small RNA detection, and gene silencing studies.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Abi steponeplus system, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Mirna reverse transcription kit, by Takara Bio (1 mentions)
Mirna specific assay kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Cel mir 39 3p standard rna, by RiboBio (1 mentions)
Transscript all in one first strand cdna synthesis supermix kit, by Transgene (1 mentions)
Perfectstart green qpcr supermix kit, by Transgene (1 mentions)
Lightcycler 96 instrument, by Roche (1 mentions)
Midetect a track mirna qrt pcr starter kit, by RiboBio (1 mentions)
Ssofast evagreen supermix, by Bio-Rad (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Cfx96 real time pcr system, by Bio-Rad (1 mentions)
Bulge loop mirna rt pcr primer set, by RiboBio (1 mentions)
Qpcr rt kit, by Toyobo (1 mentions)
Revertra ace, by Toyobo (1 mentions)
7 protocols using u6 primer
1
Quantification of miRNA and mRNA Levels
2
Exosomal miRNA and mRNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells and exosomes was extracted by TRIzol (Thermo Fisher Scientific). When the exosomes were fully lysed, 1 pmol of Cel-miR-39-3p standard RNA was added. For miRNA detection, total RNA was reverse transcribed and amplified using the miDETECT A TrackTM miRNA qRT-PCR Starter Kit (RiboBio). For mRNA detection, total RNA was reverse transcribed with a TransScript All-in-One First Strand cDNA Synthesis SuperMix kit (TransGen Biotech, Beijing, China). PerfectStart Green qPCR SuperMix kit (TransGen) was used for quantitative real-time PCR (qPCR) on a LightCycler 96 instrument (Roche, Basel, Switzerland). The relative quantification was carried out by the 2−ΔΔCT method. Cel-miR-39-3p was used as an external control for the detection of exosomal miRNAs, and U6 and β-actin were used as internal controls for cellular miRNA and mRNA detection, respectively. Cel-miR-39-3p standard RNA (Cat. miRB0000010), cel-miR-39-3p primer (Cat. miRA0000010) and U6 primer (Cat. miRAN0002) were purchased from RiboBio. Primer sequences for qRT-PCR are listed in Table S1 .
3
Quantifying miRNA Expression in HCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from HCC samples using TRIzol reagent. iScript cDNA synthesis kit, SsoFast TM EvaGreen Supermix, and the CFX96 TM Real-Time PCR system (Bio-Rad, Hercules, CA) were used for qRT-PCR reactions. MiRNA levels were normalized to U6 gene expression, and relative gene expression levels were analyzed using the ∆∆t method. The U6 primer was purchased from Guangzhou RiboBio Co., Ltd. The primers of other miRNAs were designed by our teamer and synthesized by Sangon Biotech. The primer sequences of the miRNAs were summarized in Table 1.
4
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA of cells and tissues was extracted by Life Trizol (Ambion, USA) according to the instructions. The quality and concentration of RNA were detected by NanoDrop 2000 (Thermo Fisher Scientific, USA) and cDNA was reversed transcribed with the ReverTra Ace® quantitative real-time PCR (qPCR) RT Kit (Toyobo, Osaka, Japan). Bulge-Loop™ miRNA RT-PCR Primer Sets and U6 primers were purchased from Guangzhou Ribobio, China. qRT-PCR was performed by UltraSYBR Mixture (CWbio, Beijing, China). The relative levels of miRNAs and genes were normalized by U6 and GAPDH separately. The gene primers (Tsingke, Wuhan, China) are listed in Table 1 .
5
Total RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Inc.). RNAs were reverse-transcribed to cDNA using a PrimeScript RT reagent Kit (Takara Biotechnology Co., Ltd., Dalian, China). RT-qPCR was performed using the ABI StepOnePlus system (Thermo Fisher Scientific, Inc.). Relative expression was calculated using the -2ΔΔCt method, and GAPDH was used as the internal control. U6 primers were synthesized by Ribobio (Guangzhou, China) and other primers were listed in the Supplementary Table 1 .
6
Quantitative assessment of LINC00160 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Inc.). RNAs were reverse-transcribed to cDNA using a PrimeScript RT reagent Kit (Takara Biotechnology Co., Ltd., Dalian, China). qRT-PCR was performed using the ABI StepOnePlus system (Thermo Fisher Scientific, Inc.). Relative expression was calculated using the -2ΔΔCt method, and GAPDH was used as the internal control. The PCR primers used were as follows: GAPDH, AAAAGCATCACCCGGAGGAGAA forward and AAGGAAATGAATGGGCAGCCG reverse; LINC00160, ACAGCCAACCACCCATTCTCTT forward and AGGGAAGGCAGCAGACAAAACC reverse; U6 primers were synthesized by Ribobio (Guangzhou, China).
7
Quantitative Analysis of miR-320 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from samples with RNAiso reagent (Takara, Dalian, People’s Republic of China). Real-time PCR was performed using SYBRGreen Master mix from ABI (Applied Biosystems, Foster City, CA, USA). miR-320 primers and U6 primers were purchased from RiboBio. PCR analysis was performed on an ABI 7900 system (Applied Biosystems). The relative levels of gene expression were represented as ΔCt=Ct gene–Ct reference, and the fold change of gene expression was calculated by the 2−ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!