Dna polymerase 1 klenow

Manufactured by New England Biolabs

DNA polymerase I Klenow is a recombinant version of the Klenow fragment of E. coli DNA polymerase I. It possesses 5' to 3' polymerase activity and 3' to 5' exonuclease activity, but lacks the 5' to 3' exonuclease activity of the full-length enzyme.

Automatically generated - may contain errors

Lab products found in correlation

Biotin 14 ctp, by Thermo Fisher Scientific (1 mentions) Qiaquick nucleotide removal kit, by Qiagen (1 mentions) Molecular imager fx, by Bio-Rad (1 mentions) Quantity one 4, by Bio-Rad (1 mentions)

Spelling variants of this product

DNA polymerase (79 citations) DNA polymerase I (67 citations) Klenow DNA polymerase (25 citations) Klenow polymerase (17 citations) DNA polymerase I Klenow fragment (14 citations) Klenow fragment of DNA polymerase I (8 citations) Klenow fragment of E. coli DNA Polymerase I (2 citations) [α-32P]dATP and Klenow fragment of DNA polymerase I (1 citations)

3 protocols using dna polymerase 1 klenow

Biotin-Labeling of DNA Fragments

Check if the same lab product or an alternative is used in the 5 most similar protocols

The overhangs generated by the restriction enzyme cuts were filled-in by adding a mix of biotin-14-CTP (0.4 mM stock; 18.75 μL for the 5 M to 100 k samples or 10 μL for the 50 k to 1 k samples; Life Technologies), 10 mM dATP (whichever was not supplied in biotinylated form), dGTP and dTTP (10 mM stocks; 0.75 μL of each dinucleotide for the 5 M to 100 k samples or 0.5 μL for the 50 k to 1 k samples), and 5 U/μL DNA polymerase I Klenow (5 M to 100 k samples or 4 μL for the 50 k to 1 k samples; New England Biolabs), followed by a 90 min incubation at 37 °C with gentle rotation (20 rpm).

Díaz N., Kruse K., Erdmann T., Staiger A.M., Ott G., Lenz G, & Vaquerizas J.M. (2018). Chromatin conformation analysis of primary patient tissue using a low input Hi-C method. Nature Communications, 9, 4938.

+ Open protocol

+ Expand

Electrophoretic Mobility Shift Assay for YY1

Check if the same lab product or an alternative is used in the 5 most similar protocols

Double stranded oligonucleotides were obtained by HindIII and NcoI digestion of the corresponding pBSK vector constructs. Fragments were labeled with [α‑³²P]‑dCTP and DNA Polymerase I (Klenow) (New England Biolabs, Frankfurt am Main, Germany). Electroporation of LLC-PK1 cells [ATCC CL-101] was used to efficiently express an YY1 expression vector (pCMV-YY1). About 4 μg of nuclear extract was incubated alone or with an access of competitor consensus oligonucleotide (yy1), its mutated form (yy2)⁶⁷ (link) or with YY1- or pCAF-specific antibody under binding conditions described elsewhere.⁶⁸ (link) Thereafter, 1 μl of ³²P-labeled duplex probes (20,000 cpm) was added to each reaction mix and incubated for 20–25 min at RT. The reaction mixtures were electrophoresed for 1–2 h at 100 V at 12°C in 0.5 x TBE and dried gels were exposed to an MS autoradiography film (Sigma-Aldrich) for 7–10 h at –80°C.

Bockmühl Y., Patchev A.V., Madejska A., Hoffmann A., Sousa J.C., Sousa N., Holsboer F., Almeida O.F, & Spengler D. (2015). Methylation at the CpG island shore region upregulates Nr3c1 promoter activity after early-life stress. Epigenetics, 10(3), 247-257.

+ Open protocol

+ Expand

Radiolabeled DNA Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Double-stranded DNA was created by annealing two single-stranded oligonucleotides. Wild-type oligonucleotides were 5’ AGTTGTAGGCCTCTGCTTCCTGACCAATCTACAGAATAGGCTCCGCCTTC and 5’-AGTTGAAGGCGGAGCCTATTCTGTAGATTGGTCAGGAAGCAGAGGCCTAC. Mutant oligonucleotides were 5’-AGTTGTAGGCCTCTGCTTCCTGACATGTCTACAGAATAGGCTCCGCCTTC and 5’-AGTTGAAGGCGGAGCCTATTCTGTAGACATGTCAGGAAGCAGAGGCCTAC [18 (link)]. DNA was radioactively labeled by using DNA polymerase I Klenow (New England Biolabs) to fill the 3’ single-stranded overhang with [α−³²P]dATP. Radiolabeled DNA was purified by Qiaquick Nucleotide Removal Kit (Qiagen). We incubated ~30,000 cpm of radio- labeled DNA, various amounts of protein, and 1x reaction buffer (5 mm Tris-HCl, pH 7.5, 50 mm NaCl, 1 mm MgCl2, 0.5 mm EDTA, 5% glycerol) in a total volume of 12.5 ul for 20 min on ice or at room temperature. Samples were fractionated using a 6% polyacrylamide gel (30% acrylamide/ 0.8% bis-acrylamide) with 0.5xTBE [33 ]. Gels were dried and exposed to film or a Kodak PhosphorScreen (Molecular Dynamics, Sunnyvale, CA). The PhosphorScreen was scanned using a Molecular Imager FX (Bio-Rad, Richmond, CA) and analyzed with Quantity One 4.1.0 (Bio-Rad) software.

Aklilu S., Krakowiak M., Frempong A., Wilson K., Powers C, & Fantz D. (2021). “Nfya-1 functions as a substrate of ERK-MAP kinase during Caenorhabditis elegans vulval development”. Cells & development, 169, 203757.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!