Kapa library amplification readymix

Genomic DNA was prepared from S. cerevisiae strains using the Gentra/Puregene Yeast/Bact. kit (Qiagen). Libraries of 500–700 bp fragments were prepared from genomic DNA samples^{74 (link)}. Briefly, genomic DNA samples were fragmented by sonication (Covaris) to obtain an average fragment size of 600 bp, and the fragments were blunt-ended and 5′-phosphorylated using the End-It DNA End Repair Kit (Epicentre Technologies). The DNA was then purified using the MinElute PCR purification kit (Qiagen), and 3′ ends were adenylated using Klenow DNA polymerase (NEB). Indexed Illumina adapters were then ligated to the A-tailed DNA fragments using Quick DNA Ligase (NEB), and the samples were purified using the MinElute kit. Size selection was performed using gel extraction to obtain 600–800 bp fragments, and the adapter-ligated fragments were enriched by PCR using the KAPA library amplification readymix (KAPA Biosystems) with primers AATGATACGGCGACCACCGAGATCTACAC and CAAGCAGAAGACGGCATACGAGAT. The libraries were then purified using gel extraction to select for 600–800 bp fragments. The library concentrations were measured in a Qubit fluorometer using the Qubit dsDNA HS assay kit. Sets of 12 libraries (10 nM each) were mixed for multiplexing and sequenced on an Illumina Hi-Seq 2000 instrument using the Illumina GAII sequencing procedure for paired-end short-read sequencing to obtain 50-bp reads.

DNA was extracted from green tissue that was collected from bulked stipules of four F₆ plants per line using a CTAB method [63 (link)], checking its quality on 1% agarose gel. We adopted the GBS protocol by Elshire et al. [27 (link)] with modifications. After quantification by a Quant-iT™ PicoGreen® dsDNA assay kit (Life Technologies, P7589), each DNA sample (100 ng) was digested with ApeKI (NEB, R0643L) and then ligated to a unique barcoded adapter plus a common adapter. Equal volume of the ligated product was pooled and cleaned up with QIAquick PCR purification kit (QIAGEN, 28104) for subsequent amplification. In PCR, 50 ng template DNA was mixed with two primers and KAPA Library Amplification Readymix (KAPA Biosystems KK2611). Amplification was carried out on a thermocycler for 10 cycles with 10 s of denaturation at 98 °C, followed by 30 s of annealing at 65 °C and 30 s extension at 72 °C. Each library was sequenced in two lanes on Illumina HiSeq 2000 at the Genomic Sequencing and Analysis Facility of the University of Texas, Austin, TX.