Truseq rna sample preparation v2 guide

Total RNA was extracted from silkworm tissues using the TRIzol reagent (Invitrogen) and further purified with the RNeasy kit (Qiagen). The integrity and quality of RNA were assessed using the Agilent 2100 Bioanalyzer (Agilent technologies). For non-strand-specific libraries, mRNAs were selected using oligo(dT) magnetic beads (Invitrogen), fragmented, and used to synthesize cDNA according to the TruSeq RNA Sample Preparation v2 Guide (Illumina). For strand-specific libraries, ribosomal RNA was depleted using Ribo-Zero rRNA removal beads. Then, the total RNA was purified and fragmented in fragmentation buffer. Next, the strand-specific sequencing libraries were constructed using TruSeq Stranded Total RNA Sample Preparation kits (Illumina, San Diego, CA). Libraries were sequenced on the Hiseq2000 system (Illumina, San Diego, CA). All RNA sequencing data produced in present study have been deposited in NCBI Short Read Archive (http://www.ncbi.nlm.nih.gov/sra/) and can be accessed under the SRA accession number: PRJNA284192.

High-quality total RNA was isolated from fresh grain embryos using the PureLink^®, Plant RNA Reagent kit (Ambion, Austin, United States) according to the manufacturer’s instructions. The RNA concentration was measured using NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, United States). The purity and integrity of total RNA was determined by 260/280 nm ratio and by NanoBioanalyzer RNA-6000 analysis (Agilent Technologies, Palo Alto, CA, United States). After that, 1μg of total RNA from each sample was used for RNA-Seq library construction following the specifications of the TruSeq^®, RNA Sample Preparation v2 Guide (Illumina), which was then sequenced using Illumina Hiseq 2500 in Majorbio Bio-pharm Technology Co., Ltd. (Shanghai, China).
The raw paired end reads were trimmed and quality-controlled by SeqPrep⁷ and Sickle⁸ with default parameters. The clean data were assembled using Cufflinks software, then mapped to the reference genome (ZS97RS3, RIGW3.0)⁹ via TopHat with no more than two base mismatches allowed in the alignment (Trapnell et al., 2012 (link)). The basic information of the RNA-sequencing data is provided in Supplementary Table 2.

Elizabethkingia anophelis cultures were grown overnight in LB and OD_600nm was adjusted to 0.1 by diluting the cells into 20 ml of LB supplemented with either 12 μM of FeCl₃ or 200 μM of 2, 2-dipyridyl (to create iron-deficient condition) in 250 ml flasks (Chen et al., 2010a (link)). Cells were grown at 30°C with shaking (200 rpm) for 3 h to a final OD of 0.2 or 0.5 for iron-depleted cultures or iron-replete ones, respectively. Cells grown in log-phase were re-suspended in RNAlater and frozen immediately after being harvested. RNA was isolated using Trizol reagents following the manufacturer’s manual. Residual DNA in the samples was removed using Dnase I. The integrity of the RNA was analyzed using an Agilent bioanalyzer (Agilent Technologies). The Ribo-Zero rRNA removal kit (Gram-negative bacteria, Epicentre) was used to remove the ribosomal RNA species (23S and 16S rRNA) from total RNA in samples. Library construction and sequencing were performed by Beijing Genomics Institute (BGI) using TruSeq RNA sample preparation v2 guide (Illumina). Three biological replicates of each treatment were used for RNA-Seq. The libraries were sequenced using the Illumina HiSeq 2000 platform with a paired-end protocol and read lengths of 100 bps.

ORL cell lines and NOK were lysed with TRI Reagent (Ambion, Carlsbad, CA, USA) at 70–80% confluence and extracted according to manufacturer's instructions. Libraries were constructed using 1 μg total RNA following Illumina TruSeq RNA Sample Preparation v2 Guide and 100 base pair paired-end sequencing was conducted as previously described [7 (link)].

Leaf samples of P. amarus Schum. and Thonn. cultivar, taxonomically identified by the Botanical Survey of India, Shibpur, Howrah, as PA202 were chosen for our study. Leaf samples from young, healthy plants were collected. RNA was extracted separately from leaf samples of the two samplings using “Roche High Pure RNA Isolation Kit,” (Product no.11828665001). The purity and concentration of each RNA sample were checked by using the Agilent 2100 bioanalyzer (Agilent Technologies, USA) before proceeding to further downstream analyses. Library preparation was performed from 1 μg of total RNA, using Illumina's “TruSeq® RNA Sample Preparation v2 Guide” (Part # 15026495 Rev. F March 2014).

The 450 pmol synthetic miR166b (UCGGACCAGGCUUCAUUCCCC) with 2’-O-methyl modification on its terminal nucleotide (RIBOBIO, China) was daubed on a ~1 cm² piece of mulberry leaf. Piece of leaf were fed to silkworm larvae in the fifth instar day-2 after the miRNA liquid dried. Whole silkworm larvae were collected at 3 h after ingestion of an entire piece leaf, and this experimental group (FED-miR166b) was stored at −80 °C until use. A control group of silkworm (FED-control) was only fed mulberry leaves. Each group contained three larvae. Total RNA from whole larvae were extracted by RNAiso Plus (D9108A, Takara, China) according to manufacturer’s instructions. Agilent 2100 was used to ensure the integrity of total RNA. cDNA libraries were constructed using the TruSeq RNA Sample Preparation v2 Guide (Illumina), and then sequenced by Illumina HiSeq^TM 2000. The obtained raw data from solexa sequencing were deposited on the Short Read Archive of NCBI (http://www.ncbi.nlm.nih.gov/sra/) with accession number SRP051555.