The largest database of trusted experimental protocols

Anti atg5 antibody

Manufactured by Cell Signaling Technology
Sourced in United States

The Anti-ATG5 antibody is a laboratory tool used to detect and analyze the ATG5 protein, which is involved in the process of autophagy. This antibody can be used in various experimental techniques, such as Western blotting, immunoprecipitation, and immunohistochemistry, to study the expression and localization of the ATG5 protein.

Automatically generated - may contain errors

8 protocols using anti atg5 antibody

1

Autophagy Inhibition in XTC.UC1 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
To silence the function of ATG5, XTC.UC1 cells were transfected with Atg5 siRNA (100 nM) using Lipofectamine® RNAiMAX (Invitrogenm Carlsbad, CA, USA) according to the manufacturer's protocol. The medium was replaced after 6 hr and cells were incubated for a further 48 hr. Knockdown of ATG5 was confirmed for each experiment by performing western blot analysis with anti-ATG5 antibody (Cell signaling). XTC.UC1 cells were cultured on coverslips in 12-well plates for 48 hr after seeding. Thereafter, cells were treated with 5 mM and 10 mM 3-methyladenine (3-MA; Sigma-Aldrich) or 10 and 20 nM bafilomycin A1 (BAF; Sigma-Aldrich) for 0, 12, 24, and 36 hr. After immunofluorescent staining, the stained slides were observed under a confocal microscope (Olympus Corp.).
+ Open protocol
+ Expand
2

Western Blot Analysis of Inflammasome Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
The cells were lysed in buffer containing 10 mM Tris-buffer (pH 7.6), 1% Triton X-100, 1% phosphatase inhibitor cocktail and 1 mM PMSF. The lysates were boiled in sodium dodecyl sulfate (SDS) sample buffer and were subjected to SDS–PAGE. Cytoplasmic extracts and nuclear extracts were obtained using the NE-PER Nuclear and Cytoplasmic Extraction Reagents (Sigma, 78833). Rabbit monoclonal antibodies against GAPDH, NLRP3, and ASC were purchased from Santa Cruz Biotechnology (CA, USA) and were diluted 1:1000. The anti-ATG5 antibody, anti-LC-3 antibody, anti-Caspase-1 antibody, anti-PCNA, and anti-p65 antibody were purchased from Cell Signaling Technology (Beverly, MA, USA) and were diluted 1:1000. The anti-TRIF antibody was purchased from Abcam and was diluted 1:1000. Horseradish peroxidase- conjugated goat anti-rabbit immunoglobulin G (Cell Signaling Technology, MA, USA) was used as the secondary antibody. Immunoreactive bands were identified using the ECL Western Blotting Detection System (Millipore Corporation, Billerica, MA, USA).
+ Open protocol
+ Expand
3

CRISPR-Mediated ATG5 Knockout in HEK293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T ATG5 KO cells were generated by genomic knock out using CRISPR Cas9. To this end, 3rd generation lentiviral vectors were generated as described before65 using pSicoR-CRISPR-PuroR CRISPR/Cas966 (link) constructs harbouring an ATG5 targeting sgRNA or a non-targeting (NT) sgRNA. (NT: ACGGAGGCTAAGCGTCGCAA, ATG5: AACTTGTTTCACGCTATATC)67 (link) as the transfer plasmid. HEK293T cells were transduced with the lentiviral vectors and 3 days post-transduction separated into individual cells using limited dilution. The individual cells were grown into clonal cell lines and screened for ATG5 KO using Western blot analysis (anti-ATG5 antibody, Cell Signaling Technology, #2630). Clones with a conformed knock out were expanded and stocks were conserved by cryo preservation.
+ Open protocol
+ Expand
4

Western Blot Analysis of Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were washed twice with ice-cold PBS and ruptured with CLB buffer (Cell Signaling Technology) containing PMSF and cocktail inhibitor. Cell lysates were resolved by SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA) and then blotted. Specific antibodies used are listed below: anti-Mettl3 antibody (15073–1-AP, 1:500) was from Proteintech; anti-DDIT4 antibody (1:1000) was from Proteintech; antibody to IkBα phosphorylated at Ser32 (2859S, 1:1000), anti-IkBα antibody (9234S, 1:3000), antibody to P70S6K phosphorylated at T389 (9234S, 1:1000), antibody to AKT phosphorylated at T308 (4056S, 1:1000), antibody to p65 phosphorylated at Ser536 (3031S, 1:1000), anti-NFkB p65 antibody (6956S, 1:1000), anti-ATG5 antibody (12994S, 1:1000), anti-β-actin (3700S, 1:10000), anti-Flag-HRP (2044S, 1:20000) were from Cell Signaling Technology. All of the unprocessed scans of the blots were shown in the Source Data file.
+ Open protocol
+ Expand
5

Betulinic Acid and Cell Death Mechanisms

Check if the same lab product or an alternative is used in the 5 most similar protocols
Betulinic acid (BioSolution Halle, Halle, Germany, >99% purity) was dissolved in DMSO at 4 mg/ml and stored at −80 °C. PI and CsA were purchased from Sigma-Aldrich (St. Louis, MO, USA). Rapamycin was purchased from VWR (Amsterdam, The Netherlands) and C-14 valine (CFB75-50 μCi) from Amersham Biosciences (Amersham, UK). Q-VD-OPh was purchased from R&D Systems (Minneapolis, MN, USA). Necrostatin-1 and TNF-α were obtained from Enzo Life Sciences (Farmingdale, NY, USA). Anti-LC3 antibody (51520) was obtained from Abcam (Cambridge, UK). Anti-ATG5 antibody and anti-SQSTM1/p62 were from Cell Signaling Technology (Danvers, MA, USA). Anti-αTubulin antibody was from Santa Cruz Biotechnology (Dallas, TX, USA). Annexin V-APC and 7-AAD were from BD Biosciences (Franklin Lakes, NJ, USA). Mitotracker Orange CMTMRos and JC-1 were obtained from Life Technologies (Carlsbad, CA, USA).
+ Open protocol
+ Expand
6

Cardiac Protein Analysis by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
For western blotting, total protein was extracted from cardiac tissue and myocyte cells using a RIPA buffer and separated by SDS-PAGE, and the protein concentration was examined with a BCA protein assay kit (KGP902; Keygen, China). The proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA) and blocked with 5% nonfat milk powder for 1 h. The membranes were probed with the following primary antibodies: anti-IKKε antibody (1 : 1000; Cell Signaling, #2690); anti-LC3 antibody (1 : 2000; Abcam, USA, #ab51520); anti-ATG-5 antibody (1 : 1000; Cell Signaling, USA, #2630); anti-p-AKT antibody (1 : 1000; Cell Signaling, USA, #S473); anti-AKT antibody (1 : 1000; Cell Signaling, USA, #C67E7); anti-mTOR antibody (1 : 1000, Cell Signaling, USA, #7C10); and anti-p-mTOR antibody (1 : 1000; Cell Signaling, USA, #S2448). The following day, the PVDF membranes were incubated with secondary antibodies (1 : 5000; Cell Signaling) at room temperature for 1 h. Specific proteins were detected using an ECL reagent (GE Healthcare, Piscataway, NJ, USA) and captured on Hyperfilm (Amersham, GE Healthcare). The results were then analyzed using the ImageJ software for semiquantitation of the mean gray value of each blot.
+ Open protocol
+ Expand
7

Western Blot Analysis of Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were washed twice with ice-cold PBS and ruptured with CLB buffer (Cell Signaling Technology) containing PMSF and cocktail inhibitor. Cell lysates were resolved by SDS-PAGE and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, Bedford, MA, USA) and then blotted. Specific antibodies used are listed below: anti-Mettl3 antibody (15073–1-AP, 1:500) was from Proteintech; anti-DDIT4 antibody (1:1000) was from Proteintech; antibody to IkBα phosphorylated at Ser32 (2859S, 1:1000), anti-IkBα antibody (9234S, 1:3000), antibody to P70S6K phosphorylated at T389 (9234S, 1:1000), antibody to AKT phosphorylated at T308 (4056S, 1:1000), antibody to p65 phosphorylated at Ser536 (3031S, 1:1000), anti-NFkB p65 antibody (6956S, 1:1000), anti-ATG5 antibody (12994S, 1:1000), anti-β-actin (3700S, 1:10000), anti-Flag-HRP (2044S, 1:20000) were from Cell Signaling Technology. All of the unprocessed scans of the blots were shown in the Source Data file.
+ Open protocol
+ Expand
8

Plasmid Construction for Autophagy Study

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pcDNA EGFP-RFP-LC3B plasmid encoding EGFP, RFP, and LC3B was constructed by the pcDNA 3.1 myc-his (-) vector. The pcDNA EGFP-mRFP-LC3B (ptfLC3) plasmid encoding Chlorocebus sabaeus LC3B (NCBI Reference Sequence: XM_007994295.2) was constructed by the pcDNA 3.1 myc-his (-) vector. Anti-LC3B antibody (Cell Signaling, Danvers, MA, USA, #2775), anti-SQSTM1/p62 antibody (Cell Signaling, #5114), anti-ATG5 antibody (Cell Signaling, #9980), anti-ATG12 antibody (Cell signaling, #4180), anti-LAMP1 (Cell Signaling, #3243), anti-β-actin (Santa Cruz, sc-47778), and mouse anti-PEDV antibody were made in our laboratory (immunized inactivated PEDV in mouse).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!