Log In Sign up
The largest database of trusted experimental protocols

Hexane

Manufactured by Samchun
Visit Supplier
Sourced in Japan

Hexane is a colorless, flammable liquid that is used as a solvent in various laboratory applications. It has a low boiling point and is commonly employed for the extraction and purification of organic compounds. Hexane is an aliphatic hydrocarbon with the chemical formula C6H14.

Automatically generated - may contain errors

Lab products found in correlation

Ethanol, by Samchun (5 mentions) Toluene, by Samchun (3 mentions) 3 4 ethylenedioxythiophene, by Merck Group (2 mentions) Methanol, by Samchun (2 mentions) Ethyl acetate, by Samchun (2 mentions) Acetonitrile, by Samchun (2 mentions) Ferric chloride, by Merck Group (1 mentions) Dimethylformamide, by Merck Group (1 mentions) Tetrahydrofuran, by Merck Group (1 mentions) Hexamethyldisilazane, by Merck Group (1 mentions) Butylated hydroxytoluene, by Merck Group (1 mentions) P toluenesulfonic acid monohydrate, by Merck Group (1 mentions) 4 4 6 dimethoxy 1 3 5 triazin 2 yl 4 methylmorpholinium chloride, by Merck Group (1 mentions) Polyacrylonitrile, by Merck Group (1 mentions) Sodium hydroxide (naoh), by Daejung Chemicals (1 mentions) Hydrochloric acid (hcl), by Samchun (1 mentions) N n dimethylformamide (dmf), by Thermo Fisher Scientific (1 mentions) Tetrahydrofuran, by Thermo Fisher Scientific (1 mentions) Fecl3, by Merck Group (1 mentions) 2 methyl 2 butanol, by Merck Group (1 mentions)

Spelling variants of this product

N-hexane (38 citations)

9 protocols using hexane

1

Fabrication of Serotonin Aptamer Biosensor

Check if the same lab product or an alternative is used in the 5 most similar protocols
3,4-Ethylenedioxythiophene (EDOT), polyacrylonitrile (PAN), dimethylformamide (DMF), ferric chloride, 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholinium chloride (DMTMM), hexamethyldisilazane (HMDS), 3,4-Dimethoxythiophene, p-toluenesulfonic acid monohydrate (pTsOH·H2O), butylated hydroxytoluene (BHT), tetrahydrofuran (THF), and Sylgard 184 polydimethylsiloxane (PDMS) were obtained from Sigma–Aldrich. Ethanol, toluene, mEthanol, hexane (Hex), hydrochloric acid (HCl), and ethyl acetate (EtOAc) were obtained from Samchun. Sodium hydroxide (NaOH) was purchased from Daejung. (S)-Methyl 2,3-dihydroxypropanoate (Methyl glycerate) was purchased from Combi-Block. AZ5214E was obtained from Clariant. A serotonin aptamer with the sequence 5′-CGACTGGTAGGCAGAT AGGGGAAGCTGATTCGAGCGTGGGTCG[C6 Amine]-3′ was synthesized by Bioneer. Phosphate buffered saline (PBS) pH 7.4 (1 ×) was purchased from Gibco™, and simulated blood serum and artificial CSF were purchased from Biochemazone. All reagents and solvents were used as received without further treatment.
Lim S.G., Seo S.E., Park S.J., Kim J., Kim Y., Kim K.H., An J.E, & Kwon O.S. (2022). Real-time monitoring of serotonin with highly selective aptamer-functionalized conducting polymer nanohybrids. Nano Convergence, 9, 31.
+ Open protocol
+ Expand
2

Synthesis of Conjugated Polymers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sodium, FeCl3, 2-methyl-2-butanol, 2-ethyl hexyl bromide, Pd(PPh3)4, CuI, (i-Pr)2NH, ethynyltrimethylsilane, N-bromosuccinimide, 3,4-ethylenedioxythiophene, and 2,5-dibromothiophene were purchased from Sigma-Aldrich. DMF and 2-carbonitrile thiophene were purchased from Alfa Aesar Co. Tetrahydrofuran, dichloromethane, toluene, methanol, ethyl acetate, hexane, CHCl3, and potassium carbonate were purchased from Samchun Pure Chemicals. Tetrahydrofuran (THF), diethyl ether, toluene, and methylene chloride were used after distillation in the presence of Sodium/benzophenone or calcium hydride under nitrogen gas.
Shaik B., Khan M., Shaik M.R., Sharaf M.A., Sekou D, & Lee S.G. (2021). A-π-D-π-A-Based Small Molecules for OTFTs Containing Diketopyrrolopyrrole as Acceptor Units. Micromachines, 12(7), 817.
+ Open protocol
+ Expand
3

Microalgae Extraction and Antioxidant Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tetraselmis suecica was purchased from Chloland (Geoje-si, Gyeongsangnam-do, Korea). Hexane, heptane, EA, Ace, EtOH, MeOH, acetonitrile and sodium acetate were purchased from Samchun Chemical (Kangnam-gu, Seoul, Korea). Lutein, 2,2′-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), 2,4,6 tripyridyl-S-triazine (TPTZ), Iron(III) chloride (FeCl3) and Iron(II) sulfate (FeSO4) were purchased from Sigma-Aldrich (St. Louis, MO, USA). All reagents and chemicals in this study were used above analytical grade.
Lee K.H., Jang Y.W., Kim H., Ki J.S, & Yoo H.Y. (2021). Optimization of Lutein Recovery from Tetraselmis suecica by Response Surface Methodology. Biomolecules, 11(2), 182.
+ Open protocol
+ Expand
4

Enzymatic Synthesis of Cellulose Esters

Check if the same lab product or an alternative is used in the 5 most similar protocols
Microcrystalline cellulose (MCC), 1-ethyl-3-methylimidazolium acetate ([Emim][Ac]), 40% tetrabutylammonium hydroxide (TBAH), 40% tetrabutylphosphonium hydroxide (TBPH), thiourea, Span® 85, iron oxide (Fe2O3), lipase from Candida rugosa (Type VII, 1176 U/mg), p-nitrophenyl butylate, and p-nitrophenol were purchased from Sigma Aldrich (St. Louis, MO, USA). Sodium hydroxide, ethanol, hexane, isopropyl alcohol, Congo red, and water (HPLC grade) were obtained from Samchun Pure Chemical (Gyeonggi-do, Korea). Soybean oil was purchase from SAJO Daerim (Incheon, Korea). All other chemicals used were of analytical grade and were used without further purification.
Park S., Oh Y., Jung D, & Lee S.H. (2020). Effect of Cellulose Solvents on the Characteristics of Cellulose/Fe2O3 Hydrogel Microspheres as Enzyme Supports. Polymers, 12(9), 1869.
+ Open protocol
+ Expand
5

Synthesis of Iron-based Nanomaterials

Check if the same lab product or an alternative is used in the 5 most similar protocols
Iron(ii) chloride (FeCl2·4H2O) (99%), iron(iii) chloride hexahydrate (FeCl3·6H2O) (99%), acetic acid (99.8%), hexane (99.5%), diethyl ether (99.5%), and ethanol (99.9%) were obtained from Samchun Chemical Co., Ltd. (Seoul, Republic of Korea). Ammonia solution (28%), tetraethyl orthosilicate (TEOS) (98%), (3-aminopropyl)triethoxysilane (APTES) (≥98%), and trichloroacetic acid (TCA) (99%) were obtained from Sigma Aldrich (Munich, Germany).
Tran D.T., Do C.V., Dinh C.T., Dang M.T., Le Ho K.H., Le T.G, & Dao V.H. (2023). Recovery of tetrodotoxin from pufferfish viscera extract by amine-functionalized magnetic nanocomposites. RSC Advances, 13(26), 18108-18121.
+ Open protocol
+ Expand
6

Graphite-Coated Sponge for Oil Absorption

Check if the same lab product or an alternative is used in the 5 most similar protocols
The base PU sponge (25
kg/m3) was obtained from Total Sponge Co., Ltd. Graphite
powder has a size of 20 μm or less as a coating material, and
the products of Sigma-Aldrich Chemistry Co., Ltd. were used. Ethanol
(99.0%, C2H5OH) for dispersing graphite was
purchased from Samchun Pure Chemical Co., Ltd. Dow Corning Sylgard
184 base and curing agent product was used as the curing agent for
curing PDMS and PDMS with another coating material. Toluene (99.9%,
C7H8) used for diluting PDMS was a product of
SK Chemicals. For performance testing, we used gasoline, a product
of SK energy, soybean oil, xylene (99.0%, C8H10), a Sigma-Aldrich Co., Ltd. product, and hexane (99.9%, C6H6) and chloroform (99.5%, CHCl3) from Samchun
Pure Chemical Co., Ltd. For silicone oil, KF-96 from Shin-Etsu Chemical
Co., Ltd. was used. Lastly, oil red O (dye content ≥ 75%, C26H24N4O) used for dyeing organic solvents
was purchased from Sigma-Aldrich. Co., Ltd.
Kong S.M., Han Y., Won N.I, & Na Y.H. (2021). Polyurethane Sponge with a Modified Specific Surface for Repeatable Oil–Water Separation. ACS Omega, 6(49), 33969-33975.
+ Open protocol
+ Expand
7

Cholesterol Extraction from Egg Yolks

Check if the same lab product or an alternative is used in the 5 most similar protocols
Eggs were purchased from a retail store with the average size of 62.67±0.25 g and powdered crosslinked β-CD was obtained from MSC Co. (Yangsan, Korea). Hexane (purity 95%), potassium hydroxide (purity 95%) and ethanol (purity 95%) were obtained from Samchun Chemical Co. Ltd. (Pyongtack, Korea). Cholesterol (purity 99%) was purchased from Sigma Chemical Co. (St Louis, MO, USA).
Jeong H.J., Sun H., Chogsom C, & Kwak H.S. (2014). Cholesterol Removal from Whole Egg by Crosslinked β-Cyclodextrin. Asian-Australasian Journal of Animal Sciences, 27(4), 537-542.
+ Open protocol
+ Expand
8

ITM Flower Extract Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
ITM flowers growing in Hanaro Farm (Songji-myeon, Jeollanam-do, Korea; 34°23′00.4′′ N 126°33′59.0′′ E) were collected on 12 September 2018 and identified by Jong-Cheol Yang (Baekdudaegan National Arboretum, Bonghwa-gun, Korea). A voucher specimen (No. IT-0002) was kept at the Herbarium of the College of Life and Health Science (Hoseo University, Korea). Absolute was extracted by solvent extraction method as in a previous report [16 (link)]. In brief, ITM flowers (4.05 kg) were immersed in 15 L of hexane (Samchun, Pyeongtaek, Korea) at room temperature (RT) for 1 h. Extracts were collected, and the hexane removal was carried out by a rotary evaporator (Eyla, Tokyo, Japan) at 25 °C under vacuum to obtain a dark yellow waxy residue (concrete). This residue was then dissolved in ethanol (99.5%; Samchun Chemicals, Pyungtaek, Korea), left at −20 °C for 12 h, filtered through a sintered funnel, and then evaporated at 35 °C to remove ethanol, leaving a light-yellow anhydrous wax (ITMFAb; 3.38 g, yield 0.083%, w/w). The ITMFAb obtained was stored at −80 °C until required.
Won Y.R., Won K.J., Kim D.Y., Kim M.J., Hong B.S, & Lee H.M. (2022). Chemical Composition of Impatiens textori Miq. Flower Absolute and Its Potential Wound Repair and Anti-Melanogenesis-Promoting Activities in Skin Cells. Pharmaceuticals, 15(11), 1397.
+ Open protocol
+ Expand
9

Colloidal Perovskite Nanocrystal Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
OLAM (98%), HBr (48%), Cs2CO3 (99.9%), PbO (99.999%), ODE (90%), OA (90%), and lead bromide (PbBr2, 98%) were purchased from Sigma‐Aldrich. Acetonitrile (ACN, 99.5%), toluene (99.8%), methyl acetate (99.5%), and hexane (99.5%) were purchased from Samchun Chemicals. All the chemicals were used without further purification.
Kim H., Park J.H., Kim K., Lee D., Song M.H, & Park J. (2021). Highly Emissive Blue Quantum Dots with Superior Thermal Stability via In Situ Surface Reconstruction of Mixed CsPbBr3–Cs4PbBr6 Nanocrystals. Advanced Science, 9(5), 2104660.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!