Applied biosystems 7300 sequence detection system

Total RNA samples were extracted from distinct tissues (every kind of tissues was collected from five amphioxus) of B. belcheri using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocols. The total RNA samples were then treated with RNase-free DNase (TaKaRa, Dalian, China) using a standardized protocol. Then 1 μg of total RNA were reverse transcribed to cDNA with oligodT (TaKaRa, Dalian, China). B. belcheri VLR-like homolog (Bb24355) was identified by using B. floridae Bf66946 as the BLAST query against the database of Transcriptome from v4.0 Online (data unpublished). For the analysis of Bb24355, quantitative real-time PCR was performed on an Applied Biosystems 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using a SYBR Green RT-PCR kit (DRR420A, TaKaRa, Dalian, China). Amplification reactions were incubated in a 96-well plate with a thermal cycling profile of beginning at 95 °C for 30 sec, followed by 40 cycles of 95 °C for 5 sec and 60 °C for 31 sec43 (link). All of the reactions were performed in triplicate. The sequences of the sense and antisense primers used for the amplification of Bb24355 gene were as follows: 5′- TGTCGCATGGCCTGGTTGG-3′ (sense), 5′- CGGAGCACACGAAGGAAGCC-3′ (antisense). The 18S RNA levels were used as internal control. Data were quantified using the 2^−ΔΔCt method based on Ct Values44 (link).

The total RNA was extracted from hippocampus tissues using Trizol Reagent (Invitrogen) following the manufacturer's protocol (n = 4 or 5/group). For TERT mRNA detection, total RNA (2 μg) was reverse transcribed into cDNA with AMV Reverse Transcriptase (Promega). GAPDH was used as the loading control. The qRT‐PCR assay was conducted on the Applied Biosystems 7300 Sequence Detection System using the SYBR Green master mix (Applied Biosystems). The primers were purchased from RiboBio and listed as follows: TERT, Forward: 5’‐CTGCGTGTGCGTGCTCTGGAC‐3′, Reverse: 5’‐CACCTCAGCAAACAGCTTGTTCTC‐3′; GAPDH, Forward: 5’‐TGTGGGCATCAATGGATTTGG‐3′, Reverse: 5’‐ACACCATGTATTCCGGGTCAAT‐3′. Fold change of TERT mRNA was determined by a comparative threshold cycle (Ct) method
⁵⁰ (link) with the formula 2^−ΔΔCt.

The total RNA of the MVs derived from 10⁸ cells was extracted using TRIzol Reagent (Life Technologies). Samples of total RNA were extracted for miRNAs Affymetrix GeneChip miRNA 3.0 array analysis (Life Technologies). Quantitative real-time PCR (qPCR) was performed using TaqMan microRNA probes (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. Briefly, 1 μg of the total RNA was reverse-transcribed to produce cDNA using Avian Myeloblastosis Virus reverse transcriptase (Takara, Dalian, China) and stem-loop RT primers (Applied Biosystems). Real-time PCR was performed using a TaqMan PCR kit and an Applied Biosystems 7300 Sequence Detection System (Applied Biosystems). All of the reactions, including the no-template controls, were run in triplicate. After the reactions, the CT values were determined using fixed-threshold settings.

Total RNA was extracted from cells infected with influenza virus (A/Jiangsu/1/2007(H5N1)) (MOI =1) using TRIzol Reagent according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). Quantitative RT-PCR was performed using TaqMan miRNA probes (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Briefly, total RNA was reverse transcribed to cDNA using AMV reverse transcriptase (Takara) and a stem-loop RT primer (Applied Biosystems). Quantitative PCR was performed using a TaqMan PCR kit and an Applied Biosystems 7300 Sequence Detection System (Applied Biosystems).