Sybr select master mix

Genomic DNA was isolated from peripheral blood leukocytes using a Blood DNA extraction kit (Tiangen Biotech, Beijing, China) following the manufacturer’s instruction, and dissolved in TE buffer (pH 8.0) at the concentration of 25 ng/μl. Quantitative PCR was performed using the SYBR® Select Master Mix (Takara, Dalian, China) with an ABI PRISM 7500 (Applied Biosystems, Foster City, CA, USA). The parameters were as follows: 95°C for 30 seconds, followed by 40 cycles of 95°C for 5 seconds and 60°C for 34 seconds. Primers used were as follows: Tel-1 5’GGT TTT TGA GGG TGA GGG TGA GGG TGA GGG TGA GGG t-3’, and Tel-2 5’-TCC CGA CTA TCC CTA TCC CTA TCC CTA TCC CTA TCC CTA-3’; AT1 rat-f 5’-ACG TGT TCT CAG CAT CGA CCG CTA CC-3’ and AT1 rat-r 5’-AGA ATG ATA AGG AAA GGG AAC AAG AAG CCC-3’ (Invitrogen, Carlsbad, CA, USA). The quantities of telomeric DNA were normalized to that of AT1. The relative telomere length was determined by calculating the relative ratio of telomere (T) and single gene copy AT 1 receptor (S), expressed as T/S ratio.

Third-generation SHED wasseeded in 6-well plates at a density of 1 × 10⁴ cells/well and co-cultured with osteogenic medium and scaffolds for 14 and 21 days to obtain cell pellets. Total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, United States), and cDNA was synthesised using PrimeScript RT Master Mix Perfect Real-Time Kit (Takara, Nanjing, China). SYBR Select MasterMix (Takara) was used for qRT-PCR assay to detect the expression of osteogenic differentiation markers, including ALP, bone salivary protein (BSP), runt-related transcription factor 2 (RUNX2), osterix (OSX), osteocalcin (OCN), and VEGF (in SHED and HUVECs). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was usedas an internal reference gene. All primers used in the current study was purchased from Genechem (Shanghai, China).

Trizol reagent (15,596,026, Thermo Fisher Scientific) was used to extract RNA from cells according to the manufacturer’s instructions. 1 μg of total RNA was used for reverse-transcription into cDNA using RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Fisher Scientific). Diluted cDNA was analyzed in a 7500 Real Time PCR System (Applied Biosystems/Life Technologies, Carlsbad, CA, USA) using SYBR Select Master Mix (Takara, Dalian, China). The PCR cycling condition used: 95°C 5 mins, 40 cycles of 95°C 30 sec, 60 ℃ 30 sec and 72 ℃ 60 sec. The 2^–∆∆Ct method was used to analyze the relative expression level and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 were used as the internal reference genes. All primer sequences were synthesized and purchased from Shanghai Sangon Biotechnology Co., Ltd. (Shanghai, China): SNHG10 forward: CCAGCTTAGATTCATTGATTCC, SNHG10 reverse: TTAAGTGCACCAGATGCTG; GAPDH forward: GAACGGGAAGCTCACTGG, GAPDH reverse: GCCTGCTTCACCACCTTCT; miR-1277-5p primary sequence: AAAUAUAUAUAUAUAUGUACGUAU; U6 forward: CTCGCTTCGGCAGCACA, U6 reverse: AACGCTTCACGAATTTGCGT.

Quantitative real-time polymerase chain reaction (qRT-PCR) was applied to validate the expression level of chosen lncRNA ENST00000544591, which we named as lncRNA00544. Total RNA was extracted from tissue samples and cell lines using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s instructions. After converting total RNA of lncRNA00544 to cDNA in a reverse transcription (RT) reaction, qPCR was performed using SYBR Select Master Mix (Takara, Japan) on an ABI 7900 system (Applied Biosystems, USA). Melting curve analysis was used to monitor the specificity of the PCR result. Relative expression of lncRNA00544 compared with GAPDH was determined using the comparative delta-delta CT method (2-delta Ct). All reactions were performed in triplicate. The primers of GAPDH and lncRNA00544 were synthesized by Sangon Biotech (Shanghai, China). The primer sequences were as follows:
lncRNA00544 forward: 5′-ACCTTTGAACACGATGGGACA-3′;
lncRNA00544 reverse: 5′-TCTCCTCGGGGGAGCTTAAA-3′.

Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA purity and integrity were assessed using an ND-1000 Nanodrop Instrument and an Agilent 2200 TapeStation, respectively. An NEBNext^® UltraTM Directional RNA Library Prep Kit (New England Biolabs, Ipswich, Massachusetts, USA) was used for the preparation of a RNA-seq library. Finally, the sequencing of libraries was conducted on an Illumina HiSeq™ 3000 system.
A computational pipeline was used to process RNA-seq data, which were mapped to human reference genome hg19 using TopHat v2.0.13 in conjunction with default parameters. Gfold V1.1.2 was subsequently employed to convert aligned short reads into read counts for each gene model in refseq. Differential expression was assessed by the AudicS method. The Benjamini–Hochberg multiple test correction method was enabled during the analysis. Subsequently, differentially expressed genes were chosen according to the criteria of fold change > 2 and adjusted q-value < 0.05. Finally, qRT-PCR was performed using the SYBR Select Master Mix (TaKaRa, Japan). During qRT-PCR, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the internal control. All primer sequences used in qRT-PCR are shown in Table 2.

Total RNA was extracted using TRIzol (Invitrogen, USA), and cDNA was amplified from 50 to 100 ng of RNA using the Prime Script RT Reagent Kit (TaKaRa, Japan). Gene products were analyzed by qPCR using SYBR Select Master Mix (TaKaRa) in a LightCycler 480 machine (Roche, Switzerland) in 96-well plates. The effects of CPI-637, MG-149, SAHA, prostratin and JQ1 treatment for 48 h on HIV-1 gene expression in ACH2 cells were assayed by RT-qPCR. The primers used for qPCR amplification are listed in Table 1.

Total RNA was extracted with the TRIzol reagent (Invitrogen Life Technologies). cDNA was synthesized using the PrimeScript RT Reagent kit with gDNA Eraser (Takara Bio, Inc., Otsu, Japan). qPCR was performed using the StepOne™ Real-Time PCR system (Applied Biosystems, Foster City, CA, USA), SYBR^® Green (Takara Biotechnology Co., Ltd., Dalian, China) and SYBR Select Master mix (Takara Bio, Inc., Otsu, Japan) with the following cycling condiditons: 95º°C for 30 sec and 60°C for 1 min. The primers were designed and synthesized by BGI company (Shenzhen, China). β-actin mRNA was used as an endogenous control. The relative expression of RNA was calculated using the comparative Ct method (2^−ΔΔCT).