Miseq 2000

Soil fungal community profiling follows established protocols [25 ]. Briefly, soil DNA was extracted from 0.25 g using the PowerSoil DNA isolation kit (MoBio Laboratories Inc., Carlsbad, CA, USA), following the manufacturer’s instructions. The fungal ITS2 genomic region was amplified by PCR using the fITS7 (5′‐GTGARTCATCGAATCTTTG‐3′) and the ITS4 primers (5′‐TCCTCCGCTTATTGATATGC‐3′) [26 (link)]. The purified equimolar-pooled amplicon library was sequenced using 300‐bp paired‐end Illumina MiSeq 2000 sequencing (Illumina Inc., San Diego, CA, USA) at the Berlin Centre for Genomics in Biodiversity Research (BeGenDiv, Berlin, Germany).

DNA extraction, 16S library preparation and sequencing were performed according to standard protocols from the Earth Microbiome project (http://www.earthmicrobiome.org/protocols-and-standards/ [21 (link)]). Briefly, DNA extraction was performed using the MO BIO PowerSoil DNA Isolation Kit (MoBio Laboratories). PCR amplification targeting the V4 region of the 16S rRNA bacterial gene was performed with barcoded primers 515F/806R as described in [22 (link)]. Equal amounts of amplicons from each sample were pooled in equal concentration and cleaned with the MoBio UltraClean PCR Clean-Up Kit. Library was PhiX-spiked and sequenced on the UC San Diego Institute for Genomic Medicine Illumina MiSeq2000 platform.

Illumina sequencing was carried out as described previously^{19 (link),20 (link),26 (link)}. Briefly, we prepared the DNA adaptor for Illumina by annealing oligonucleotides oCJ25 and oCJ26 (Supplementary Table S5). The oligonucleotides were mixed in equal volumes and placed at 96 °C for 2 min; 2 μl of annealed adaptor was ligated to processed genomic DNA using 1.5 μl of T4 DNA ligase and 3.5 μl of 10 × ligase buffer from NEB at 16 °C overnight and then purified with Qiagen PCR purification kit and eluted with 50 μl of 10 mM TRIS–HCl buffer (pH 8.5). 2 μl of each DNA mixture was used as a template in a 50 μl PCR reaction for 20 cycles using primers oCJ23 and oCJ22 (Supplementary Table S5). Amplified DNA was purified using 1% agarose gel electrophoresis, and the 128 bp band was recovered in 14 μl 10 mM TRIS–HCl buffer (pH 8.5) with Qiagen DNA Gel-extraction mini kit. The sequencing of the Tn-chromosome junctions was performed using a MiSeq 2000 (Illumina) at the Tufts University Core Facility, Boston, MA with oCJ24 and oCJ27 primers to obtain unique barcode sequences for each experimental group (Supplementary Table S5). The complete Tn-seq results have been deposited in NCBI SRA (https://www.ncbi.nlm.nih.gov/sra) with the accession number PRJNA628733 (BioSamples SAMN14749977-SAMN14749985).

Soil subsamples (approximately 10 g per subsample, without replacement) were collected in the four microcosms after 0, 1, 3, 5, 7 and 10 incubation days to investigate the taxonomic structure of microbial communities. The extraction of total genomic DNA was performed using the FastDNA SPIN kit for Soil^® (MP Biomedicals, Solon, OH, USA.). DNA was eluted in 100 µL nuclease-free water. Quality of the DNA was then examined on agarose gels and samples were quantified using Quantifluor dsDNA System^® (Promega, Fitchburg, WI, USA). The V4 region of bacterial 16S rRNA gene was PCR amplified (Table S1) and sequenced on an Illumina MiSeq 2000 instrument as multiplexed libraries to generate paired-end reads (2 × 250 bp). Quantification of bacterial 16S rRNA and hhyL genes was done by qPCR following Khdhiri et al. (2015) (link).

Total DNA of strain JQ581 was extracted using a QIAGEN DNA kit. Library preparation and genome sequencing were performed by BaseClear BV (Leiden, The Netherlands). A paired-end DNA library with a mean gap length size between 200 and 350 bp was sequenced, with average reads of 250 bp, on an Illumina Miseq2000 apparatus. The draft genome sequence was assembled using the SOAPdenovo version 2.04. Functional annotation was performed with the Rapid Annotation Subsystem Technology (RAST) server [38 (link)] and the National Center for Biotechnology Information’s Prokaryotic Genome Automatic Annotation Pipeline (PGAAP). The reported genes involving the degradation of nicotine or NA were used to blast the genome of strain JQ581 in NCBI.

The B. colvilei (GJ2, GJ3) and B. sessilifolia (GJ9, GJ10, GJ11) plant samples were collected from Goruwale, Mechi, Nepal and Yadong, Tibet, China, B. sessilifolia plant samples were collected from the Gaoligong mountain, Yunnan, China, and the Gaoligong Mountain, Myanmar. Table S2 gives details of the collections. Total genomic DNA was extracted from 100 mg fresh leaves using a modified CTAB method [50 (link)]. The complete cp genome sequencing was performed on the Illumina MiSeq 2000 (Illumina Inc, San Diego, CA, USA), at the Laboratory of Molecular Biology of Germplasm Bank of Wild Species in Southwest China, following the method of Yang [51 (link)]. The Illumina raw sequence reads were edited using the NGS QC Tool Kit v2.3.3 [52 (link)], with a cut-off value of 80 and 30 respectively for percentage of read length and PHRED quality score respectively. High-quality reads were assembled into contigs using the de novo assembler SPAdes 3.9.0 [53 (link)], using a k-mer set of 93, 105, 117, 121. The de novo contigs were assembled into complete chloroplast genomes by further connection using NOVOPlasty version 2.6.2 [54 (link)].