Sodium arsenite 0.1 n standardized solution

Sodium arsenite 0.1 N standardized solution was purchased from Alfa Aesar, STA-9090 was purchased from MedChem Express, MAL3-101 was purchased from ChemTech, Inc., and Shield-1 was purchased from ClonTech. FLuc-GFP.pCIneo was a generous gift from Prof. F.-U. Hartl (Max Planck Institute).^{45 (link)} pTDtomato-N1-Q0-TDtomato and pTDtomato-N1-polyQ67-TDtomato plasmids were a generous gift from Prof. R. Morimoto (Northwestern).^{41 (link)} To construct dn-cHSF1.pENTR1A and DHFR.dn-cHSF1.pENTR1A, the DNA fragment corresponding to dn-cHSF1 was PCR-amplified using DNA oligonucleotides aaaaaaggtaccaccatggatctgcccgtggg and aaaaaagcggccgcctacaggcaggctacgctga as primers and cHSF1.pENTR1A as the template.^{36 (link)} The PCR product was digested with KpnI and NotI, and then cloned into KpnI- and NotI-digested pENTR1A (Life Technologies) or DHFR.YFP.pENTR1A vectors.^{38 (link)} Genes of interest in pENTR1A were shuttled into appropriate destination vectors using LR clonase II-mediated recombination (Life Technologies). The following antibodies were used: mouse monoclonal anti-β-actin from rabbit polyclonal anti-HSF1 from Sigma, anti-HSP70/72 and anti-HSP40/Hdj1 from Enzo Life Sciences, rabbit monoclonal anti-HSP90 from Cell Signaling, and rabbit polyclonal anti-GFP from GeneTex.