The largest database of trusted experimental protocols

Apa assay

Manufactured by Cytoskeleton
Sourced in United States

The APA assay is a lab equipment product developed by Cytoskeleton. It is designed to measure the actin polymerization activity (APA) of samples, providing insights into the dynamics of the actin cytoskeleton. The core function of the APA assay is to quantify the rate and extent of actin polymerization in a given sample.

Automatically generated - may contain errors

2 protocols using apa assay

1

Proteomic and Transcriptomic Analysis of Naa10 and Naa15

Check if the same lab product or an alternative is used in the 5 most similar protocols
70–120 mg tissues were lysed in 5 μL/mg tissue RIPA buffer (Sigma) with 1× Complete protease inhibitors and 1 U/μL Superase In RNase inhibitor (Thermo Scientific) using Fisherbrand Pellet Pestle Cordless Motor. Afterwards, homogenization debris was removed by centrifugation at 20.800 × g for 10 min at 4°C. Protein concentration was determined using APA assay (Cytoskeleton Inc) and 50 μg total protein were separated on SDS-PAGE followed by western blot. Membranes were stained with anti-Naa10, anti-Naa15, and anti-GAPDH antibodies (all Abcam).
For RNA purification, 30 μL clarified lysates were mixed with 70 μL RNase free water and RNA isolated using the RNeasy Mini Kit (Qiagen) according to the manufacturers recommendations, including on-column Dnase digest. 1 μg RNA was reverse transcribed using the TaqMan Reverse transcription kit and gene level detection performed using SYBR Green Master Mix (all Thermo Scientific). Relative expression was normalized to GAPDH and ACTB.
For the characterization of the mNaa12 antibody, tissue was lysed in 2 µL per mg tissue PBS-X (PBS + 0.2% [v/v] Triton X-100 + 1× Complete protease inhibitor cocktail). 10–200 µg lysate were subjected to SDS-PAGE and western blot.
+ Open protocol
+ Expand
2

N-terminal Acetylation Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Organs from mice were dissected >2 months after birth. 70–120 mg tissue (heart/kidney/liver) were lysed in 5 μl/mg tissue RIPA buffer (Sigma) with 1x Complete protease inhibitors and 1 U/μl Superase In (Thermo Scientific, Waltham, MA, USA) using Fisherbrand Pellet Pestle Cordless Motor. After homogenization debris was removed by centrifugation at 20.800 g for 10 min at 4°C. Protein concentration was determined using APA assay (Cytoskeleton Inc. Denver, CO, USA) and 50 μg total protein were separated on SDS-PAGE followed by western blot. Membranes were stained with anti-Naa10, anti-Naa15 and anti-GAPDH antibodies (all Abcam, Waltham, MA,USA). For RNA purification, 30 μl clarified lysate were mixed with 70 μl RNase free water and RNA isolated using the RNeasy Mini Kit (Qiagen, Germantown, MA, USA) according to the manufacturer’s recommendations, including on-column Dnase digest. 1 μg RNA was reverse transcribed using the TaqMan Reverse transcription kit and gene level detection performed using SYBR Green
Master Mix (all Thermo Scientific). Relative expression was normalized to GAPDH and ACTB. The following primer pairs were used:
Naa10 (exon2-4) CTCTTGGCCCCAGCTTTCTT & TCGTCTGGGTCCTCTTCCATNaa11 ACCCCACAAGCAAAGACAGTG & AGCGATGCTCAGGAAATGCTCTGAPDH AGGTCGGTGTGAACGGATTTG & TGTAGACCATGTAGTTGAGGTCAACTB GGCTGTATTCCCCTCCATCG & CCAGTTGGTAACAATGCCATGT
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!