Infected HUVECs were lysed with 200 µL 2x sample buffer with β-mercaptoethanol and boiled at 95°C for 5 min. 10µL of protein sample was loaded to a 6% or 10% SDS-PAGE gel, followed by transfer to Immobilon-P PVDF membrane (Millipore). Membranes were briefly washed and then blocked with 5% skim milk in wash buffer for 30 min. Membranes were incubated overnight at 4°C with anti-PRDM16 (R&D, 1:1000), anti-GAPDH (Millipore, 1:3000), or anti-ANGPT2 (R&D, 1:500) antibodies. After washing, membranes were incubated with anti-sheep-HRP (Sigma, 1:1000), anti-mouse-HRP (GE Healthcare, 1:1000), or anti-Goat-HRP (Millipore, 1:5000) secondary antibodies at room temperature for 1.5 h. Membranes were washed and then imaged on a ChemiDoc (Bio-Rad) using SuperSignal West Pico PLUS (ThermoFisher) or combined Pico PLUS and Femto Chemiluminescent Substrates (ThermoFisher, 9:1).
Anti prdm16
Manufactured by R&D Systems
Sourced in United States
Anti-PRDM16 is a laboratory reagent used for detection and quantification of the PRDM16 protein. PRDM16 is a transcriptional regulator involved in the development and function of brown and beige adipose tissue. Anti-PRDM16 can be used in various applications such as Western blot, immunohistochemistry, and ELISA to study the expression and localization of PRDM16 in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Anti ucp1, by Abcam (3 mentions)
Anti β actin, by Merck Group (2 mentions)
Immobilon p pvdf membrane, by Merck Group (1 mentions)
Femto chemiluminescent substrate, by Thermo Fisher Scientific (1 mentions)
Anti gapdh, by Merck Group (1 mentions)
Supersignal west pico plus, by Thermo Fisher Scientific (1 mentions)
Chemidoc, by Bio-Rad (1 mentions)
Anti pparα, by Santa Cruz Biotechnology (1 mentions)
Anti α tubulin, by Merck Group (1 mentions)
Anti β actin, by Abcam (1 mentions)
Alexa fluor 594 conjugated anti rabbit, by Abcam (1 mentions)
Anti c ebpβ, by Santa Cruz Biotechnology (1 mentions)
Hyperactive universal cut tag assay kit, by Vazyme (1 mentions)
Anti lamin a c, by Santa Cruz Biotechnology (1 mentions)
Igepal ca 630, by Merck Group (1 mentions)
Complete mini, by Roche (1 mentions)
Protease and phosphatase inhibitor cocktail, by Roche (1 mentions)
7 protocols using anti prdm16
1
Western Blot Analysis of PRDM16, GAPDH, and ANGPT2
2
Protein Expression Analysis in Adipose Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells or tissues were lysed in radioimmunoprecipitation assay buffer (0.5% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 150 mmol/L NaCl, 50 mmol/L Tris-Cl, pH 7.5). Proteins were separated using 7–10% SDS-PAGE, transferred to a polyvinylidene fluoride membrane, and probed with the following antibodies: anti-PRDM16 (R&D Systems), anti-PPARGC1α (Abcam), anti-PPARα (Santa Cruz Biotechnology), anti-KSRP (37 (link)), anti-UCP1 (Abcam), anti-β-actin (Abcam), and anti-α-tubulin (Sigma-Aldrich).
3
Protein Expression Analysis in Adipocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in RIPA buffer containing 150 mmol/L sodium chloride, 1.0% TritonX-100, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), and 50 mmol/L Tris with freshly added protease and phosphatase inhibitor cocktail (Roche Diagnostics Corp, USA). Equal amounts of protein were distributed in 10% SDS-polyacrylamide gel After electrophoresis, the proteins were transferred to a polyvinylidene fluoride (PVDF) membranes, incubated with blocking buffer (5% fat-free milk) for 1 h at room temperature, and blotted with the following antibodies overnight (4 ℃): anti-PRDM16 (Cat# AF6295, RRID:AB_10717965; R&D Systems, USA), anti-UCP1 (Cat# ab209483, RRID: AB_2722676; Abcam, UK), anti-PPARγ (Cat# 2430; RRID: AB_823599; CST, USA), anti-HSP90 (Cat# 4874; RRID: AB_2121214; CST, USA) and anti-β-actin (Cat# A5441, RRID:AB_476744, Sigma, USA). The dilution ratio of anti-PRDM16, anti-UCP1, anti-PPARγ and anti-HSP90 was 1:1000 and the dilution ratio of anti-β-actin was 1:10000. The membranes were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at room temperature. Signals were visualized using a Mini ChemiTM 580 (Sage Creation Science, China) with Super Signal West Pico Chemiluminescent Substrate (Pierce, USA).
4
Histological and Immunofluorescence Analysis of Beige Adipocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues were fixed in 4% paraformaldehyde (PFA) for 24 h, and then dehydrated and embedded in paraffin. The paraffin blockers were cut into 5 μm sections and stained with hematoxylin and eosin. The H&E images were taken from histological light microscopy (Olympus BX51) and adipocyte diameter was measured by imageJ software.
For immunofluorescence staining, SVF-derived beige adipocytes were washed twice with PBS and then fixed with 4% paraformaldehyde (PFA) for 20 min at 22 °C. After washing, the fixed cells were permeabilized with 0.5% Triton X-100 (Lablead) for 20 min and then blocked with 5% BSA for 30 min at 22 °C. After washing, the adipocytes were incubated with anti-PRDM16 (R&D, 1:50), anti-YAP (CST, 14074, 1:100) or anti-TAZ (CST, 83669, 1:100) at 4 °C overnight. After washing with PSBT, the adipocytes were incubated with Alexa Fluor 488-conjugated anti-sheep (Invitrogen, A11015, 1:300) and Alexa Fluor 594-conjugated anti-rabbit (Abcam, ab150080, 1:300) for 1 h at 22 °C, followed by counterstaining with DAPI (CST, 1:5000). Adipocytes were imaged using Nikon A1RSi+ Confocal Imaging Systems for Fluorescence.
For immunofluorescence staining, SVF-derived beige adipocytes were washed twice with PBS and then fixed with 4% paraformaldehyde (PFA) for 20 min at 22 °C. After washing, the fixed cells were permeabilized with 0.5% Triton X-100 (Lablead) for 20 min and then blocked with 5% BSA for 30 min at 22 °C. After washing, the adipocytes were incubated with anti-PRDM16 (R&D, 1:50), anti-YAP (CST, 14074, 1:100) or anti-TAZ (CST, 83669, 1:100) at 4 °C overnight. After washing with PSBT, the adipocytes were incubated with Alexa Fluor 488-conjugated anti-sheep (Invitrogen, A11015, 1:300) and Alexa Fluor 594-conjugated anti-rabbit (Abcam, ab150080, 1:300) for 1 h at 22 °C, followed by counterstaining with DAPI (CST, 1:5000). Adipocytes were imaged using Nikon A1RSi+ Confocal Imaging Systems for Fluorescence.
5
CUT&Tag Profiling of Beige Adipocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CUT&Tag was performed by using Hyperactive Universal CUT&Tag Assay Kit (Vazyme, TD903) according to the manufacturer’s protocols. In brief, in the 6th day of differentiation, the SVF-derived beige adipocytes were digested from the cell plate, and around 5 × 105 cells in 1.5 mL tude per group were used to do the assay. After binding to ConA beads, the nuclei of adipocytes were incubated at 4 °C overnight with anti-PRDM16 (R&D, 1:50) or anti-C/EBPβ (Santa Cruz Biotechnology, 1:100) and the corresponding IgG control, respectively. Washing for 3 times, the nucleus-ConA beads were incubated with anti-sheep or anti-mouse secondary antibody for 1 h at 22 °C. After washing, the nucleus-ConA beads was incubated with pA/G-Tnp and get the target DNA fragments followed by DNA extraction procedure.
For DNA library amplification, the extracted DNA was used to do PCR for 15 cycles with adaptor primers as F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG, followed by DNA product purification procedure. RT-qPCR was performed to detect the relative enrichment of targeted DNA product. The qPCR primers used for the indicated promoter region of S100b are F: 5’-CACTTCCTACCCAACAGACC-3’, R: 5’-AGGATAGGGAGGAGTTAGACAC-3’.
For DNA library amplification, the extracted DNA was used to do PCR for 15 cycles with adaptor primers as F: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, R: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG, followed by DNA product purification procedure. RT-qPCR was performed to detect the relative enrichment of targeted DNA product. The qPCR primers used for the indicated promoter region of S100b are F: 5’-CACTTCCTACCCAACAGACC-3’, R: 5’-AGGATAGGGAGGAGTTAGACAC-3’.
6
Isolation and Fractionation of Nuclear Extracts from Adipose Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen iWAT and iBAT were minced and homogenized in a hypotonic buffer (10 mM HEPES, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, and 1x protease inhibitor cocktail (cOmplete Mini, Roche)) by a dounce homogenizer. Homogenate was incubated on ice for 10 min and then mixed with 1/20 vol of 10% IGEPAL CA-630 (Sigma-Aldrich, I8896). Samples were then filtered through a 100 μm cell strainer and centrifuged at 1000 x g for 10 min. After centrifugation, lipid and cytoplasmic fractions were removed and nuclear pellets were resuspended in lysis buffer (20 mM HEPES, 1.5 mM MgCl2, 0.42 M NaCl, 0.2 mM EDTA, 0.5 mM DTT, 1x protease inhibitor cocktail, and 20% Glycerol). Samples were incubated on ice for 30 min and vortexed for 15 s every 10 min during the incubation. After lysis, samples were centrifuged at 20,000 x g for 10 min and the supernatant was taken as the nuclear extract. The following antibodies were used in immunoblotting: anti-PRDM16 (1:500, R and D systems, AF6295), anti-Lamin A/C (1:2000, Santa Cruz, sc-376248).
7
Western Blot Analysis of Adipogenesis Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in RIPA buffer containing 150mM sodium chloride, 1.0% TritonX-100, 0.5% sodium deoxycholate, 0.1% SDS, 50mM Tris with freshly added protease and phosphatase inhibitor cocktail (Roche Diagnostics Corp, Pleasanton, CA, USA). Equal amount of protein samples were distributed in 10% SDSpolyacryl-amide gels. After electrophoresis, proteins were transferred to a PVDF membrane, incubated with blocking buffer (5% fat-free milk) for 1 h at room temperature, and blotted with the following antibodies overnight: anti-PRDM16 (R&D), anti-UCP1 (Abcam), anti-PPARγ (CST) and anti-β-actin (SigmaChemical). The membrane was incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Signals were visualized using Mini Chemi TM 580 (Sage Creation Science Co, Beijing, China) with Super Signal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!