Syber green mix

ChIP was performed as previously described (34 (link)). Immunoprecipitated DNA was quantified by polymerase chain reaction (PCR) using the Syber Green mix (Kapa) and all precipitations, except for those performed on histones and histone modifications, were compared to signals at the H27 site in the 45S rDNA (35 (link)) or to the actin promoter. The primer pairs used are given in the Supplementary Information (Supplementary Tables S2 and S3). Antibodies used were WSTF (Abcam), SNF2h (Abcam), RNA pol III (kind gift from Dr. Henry and from Abcam), TFIIIA (Abcam), TFIIIC220C (Santa Cruz and Abcam), Brf1 (Abnova and Abcam), GCN5 (Abcam), PCAF (Abcam), p300 (Abnova), TRRAP (Santa Cruz), c-Myc (Santa Cruz and Abcam), Max (Santa Cruz and Abcam), RNA pol II CTD (Abcam), H3-Ac, H3K9-Ac, H3K14-Ac, H3K27-Ac, H3K4-me3, H3K9-me3, H3K27-me3, H4, H4K8-Ac and H4K16-Ac (Abcam).

1μl of respective cDNA was used in PCR reaction mix containing specific gene primers and 2X Syber Green mix (KAPA Biosystems). Sybr Green mix contains SYBR green I dye and required PCR reagents like dNTPs, DNA polymerase and compatible buffers. The first-strand cDNA synthesized was used for Real-Time/ quantitative PCR (RT-PCR/ qPCR). To the 2X SYBR Green master mix, specific primers (forward and reverse), cDNA and high ROX (for normalization) were added. The reaction was carried out in the StepOnePlus Real-time PCR system. The data was analysed in StepOne software v2.3. PCR conditions were standardised for each set of gene primers used. Fold expression change was calculated using ΔΔCt method using either Actin or U6SnRNA (in case of miRNAs) gene primers for normalization. Sensitivity and specificity of the primers were ascertained by melt curve analysis. The sequences of the primers are given below. For miRNAs universal Reverse primer from the NCODE VLO cDNA synthesis kit (Invitrogen) was used. Primers used are given as follows: hsa-miR-29a: ACCATCTGAAATCGGTTAAAA, hsa-miR-29b: CACCATTTGAAATCAGTGTTAAA, has-miR-29c: CACCATTTGAAATCGGTTAA, PC4 Fp: AGGTGAGACTTCGAGAGCCCTGT, PC4 Rp: TTCAGCTGGCTCCATTGTTCTGG, Actin Fp: AGATGTGGATCAGCAAGCAGGAGT, Actin Rp: TCCTCGGCCACATTGTGAACTTTG, U6SnRNA: GGAACGCTTCACGAATTAA.

Quantitative PCR was performed with a miDETECT A Track^TM system (Ribobio, Guangzhou, China). MiRNA qRT-PCR Primer Sets (one RT primer and a pair of qPCR primers for each set) specific for miR-146a were obtained from this system. All steps were conducted according to the manufacturer’s instructions. Total RNA was isolated using TRIzol reagent (Invitrogen, United States). MicroRNAs were reverse transcripted after treatment with a method to achieve poly (A) addition. The qPCR recycling program was 95°C for 2 s and 60°C for 30 s, which was performed with SYBER Green mix (Roche, Switzerland) using the a PCR instrument (Applied Biosystems, United States). Each reaction was performed in duplicate and contained a negative control reaction. Data were analyzed by the 2^–ΔΔCt method and U6 was used as an endogenous control.