Serum anti-DsRed antibodies were detected using the Amplex ELISA Development Kit for Mouse IgG with Amplex UltraRed reagent (Life Technologies). Corning 96-well ELISA plates were coated with 10 μg/ml recombinant DsRed (Clontech) and incubated overnight at 4°C. The next day plates were washed 3 times with PBS containing 0.1% Tween-20 and blocked overnight at 4°C with PBS containing 1% bovine serum albumin. All serum samples were then diluted serially (3-fold dilutions) from 1:10 to 1:1,771,470 and incubated for 1 h at room temperature (RT) on the DsRed coated plates. An anti-DsRed antibody (Clontech) was used as a positive control for this assay and an anti-GFP antibody (Clontech) was used as a negative control. Afterward, plates were washed 3× with PBS/Tween-20 and incubated for 30 min at RT with 50 ng/ml of goat anti-mouse IgG horseradish peroxidase, washed 3× with PBS/Tween-20, and incubated for 30 minutes with Amplex Red at RT in a dark chamber. Fluorescence was quantified using a Varioskan Flash fluorometer (530 nm excitation; 590 nm emission) (ThermoScientific).
Anti dsred antibody
Manufactured by Takara Bio
Sourced in United States
The Anti-DsRed antibody is a laboratory reagent produced by Takara Bio. It is a highly specific antibody that recognizes the DsRed fluorescent protein, a commonly used reporter protein in biological research. The antibody can be used to detect and localize DsRed-tagged proteins in various experimental applications.
Automatically generated - may contain errors
Lab products found in correlation
Lsm 780 confocal microscope, by Zeiss (3 mentions)
Lsm800 confocal microscope, by Zeiss (2 mentions)
Anti gfp antibody, by Takara Bio (1 mentions)
Varioskan flash fluorometer, by Thermo Fisher Scientific (1 mentions)
Vectashield, by Vector Laboratories (1 mentions)
Eclipse 80i fluorescent microscope, by Nikon (1 mentions)
Eclipse ti, by Nikon (1 mentions)
Living colors, by Takara Bio (1 mentions)
Anti mouse igg1 fitc, by Southern Biotech (1 mentions)
Ab6658, by Abcam (1 mentions)
A31572, by Thermo Fisher Scientific (1 mentions)
A11055, by Thermo Fisher Scientific (1 mentions)
B5002, by Merck Group (1 mentions)
A31571, by Thermo Fisher Scientific (1 mentions)
Click it plus tunel assay, by Thermo Fisher Scientific (1 mentions)
Alexa fluor 488 goat anti rabbit secondary antibody, by Thermo Fisher Scientific (1 mentions)
Click it edu alexa fluor 647 imaging kit, by Thermo Fisher Scientific (1 mentions)
Tcs sp5 2 confocal microscope, by Leica (1 mentions)
10 protocols using anti dsred antibody
1
Detection of Serum Anti-DsRed Antibodies
2
Fixation and Immunostaining of Fly Brains
3
Immunostaining of Transgenic Hydra Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The NvElav1::mOrange transgenic embryos were fixed with 4% paraformaldehyde/PBT for 1 h at room temperature and stained using anti-DsRed antibody (1:300 dilution)(Clontech), as was previously reported14 (link). For neuropeptide staining, embryos and primary polyps were fixed by Zamboni’s fixative o/n at 4 °C. After permeabilization in PBS+0.1% Triton X-100, specimens were blocked with blocking solution (10 mg ml−1 BSA+5% normal goat serum in PBS), incubated with anti-FMRFamide antibody (1:600 dilution) (Sigma) or anti-GLWamide antibody (1:400 dilution) (a gift from Dr Koizumi) in the blocking solution containing 0.1% Triton X-100, and then with Alexa488- or Alexa568-conjugated anti-Rabbit antibody (1:800 dilution) (Invitrogen). Specimens were imaged using a Nikon ECLIPSE 80i fluorescent microscope equipped with DIGITAL SIGH DSU1 (Nikon). For confocal microscopy, a fluorescent microscope ECLIPSE Ti (Nikon) equipped with an A1R MP confocal scanner (Nikon) was used.
4
Immunohistochemical Analysis of Zebrafish Hearts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IHC of embryonic zebrafish hearts for quantification of cardiomyocytes was performed as previously described38 (link). Primary antibodies used were: Amhc (Atrial myosin heavy chain; University of Iowa Developmental Studies Hybridoma Bank) and Living Colors® polyclonal anti-DsRed antibody (Clontech). Secondary antibodies used were anti-mouse IgG1-FITC (Southern Biotech) and anti-rabbit IgG-TRITC (Southern Biotech). A Zeiss M2BioV_12 Stereo microscope was used to image hearts. Additional antibody information is included in Supplementary Table 2 .
5
Protein-Protein Interaction Screening
6
ChIP Assay for p21 Promoter Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation (ChIP) assays using anti-DsRed antibody (Clontech) and quantification of precipitated DNA were performed as described previously [21 (link)]. Primers used were: p21(−2000), gcgacagggctgggatctgatgc and ccagacacactctaagggaggac; p21(−1500), gcagtggggcttagagtgggg and gcagacccccttggcctgcctcg; p21(−1000), ggtagatgggagcggatagacac and gcctcctgcccggggctctctgc; p21(−500), gttggggtgtctaggtgctccag and caccgctgacccactctggcaggc; p21(−1), ggccccggggagggcggtc and gatatacaaccgccccgcc.
7
BrdU Labeling and TUNEL Assay in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BrdU (B5002, Sigma-Aldrich) was dissolved in PBS to a stock concentration of 10 mg/ml. A total of 166.7 μg BrdU per gram of body weight was intraperitoneally injected for five consecutive days at different desired stages. At 6 dpi, injected fish were sacrificed, and the brains were dissected for further cryo-section. For each fish, two adjacent brain section slices were collected separately on two slides and were subjected to anti-BrdU and TUNEL staining, respectively.
BrdU staining was performed as previously reported (60 (link)). TUNEL assay was performed using Click-iT Plus TUNEL assay (Invitrogen, C10619). Subsequent immunostaining was performed as previously described (61 (link)). Primary antibodies used in this study are anti-GFP antibody (ab6658, Abcam), anti-DsRed antibody (632496, Clontech), anti-BrdU antibody (11170376001, Roche), anti–caspase 3 antibody (559565, BD Biosciences), and anti-Lcp1 antibody (30 (link)). The secondary antibodies used in this study are Alexa 488 anti-goat antibody (A11055, Invitrogen), Alexa 555 anti-rabbit antibody (A31572, Invitrogen), and Alexa 647 anti-mouse antibody (A31571, Invitrogen).
BrdU staining was performed as previously reported (60 (link)). TUNEL assay was performed using Click-iT Plus TUNEL assay (Invitrogen, C10619). Subsequent immunostaining was performed as previously described (61 (link)). Primary antibodies used in this study are anti-GFP antibody (ab6658, Abcam), anti-DsRed antibody (632496, Clontech), anti-BrdU antibody (11170376001, Roche), anti–caspase 3 antibody (559565, BD Biosciences), and anti-Lcp1 antibody (30 (link)). The secondary antibodies used in this study are Alexa 488 anti-goat antibody (A11055, Invitrogen), Alexa 555 anti-rabbit antibody (A31572, Invitrogen), and Alexa 647 anti-mouse antibody (A31571, Invitrogen).
8
Quantifying Proliferation in Lateral Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryos were anaesthetized by immersion in Tricaine and injected directly in to the yolk mass with 5 nl of 5 mM 5-ethynyl-2'-deoxyuridine (EdU) in 0.15x Danieau's solution at 52 hpf. They were then incubated at room temperature for 1 h to enable EdU incorporation prior to overnight fixation in 4% paraformaldehyde. Fixed embryos were stored in methanol for at least 24 hours, then rehydrated and permeabilised in acetone at -20ºC for 10 min. EdUlabeled cells were detected using a Click-iT EdU Alexa Fluor 647 imaging kit (Life Technologies). mRFP was subsequently immunostained using a rabbit polyclonal anti-DsRed antibody (Clontech) and Alexa Fluor 488 goat anti-rabbit secondary antibody (Life Technologies). Fluorescence was visualized using a Leica TCS SP5 II confocal microscope.
EdU-labelled cells were counted in 100 µm segments along the posterior lateral line nerve (PLLn) in 3 specimens per group. Graphpad Prism was used to calculate mean cell counts ± S.E.M. and statistical significance determined using a Mann-Whitney U test.
EdU-labelled cells were counted in 100 µm segments along the posterior lateral line nerve (PLLn) in 3 specimens per group. Graphpad Prism was used to calculate mean cell counts ± S.E.M. and statistical significance determined using a Mann-Whitney U test.
9
Fluorescent Visualization of GLP-1R Expression in Brain Vasculature
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice expressing fluorescently tagged GLP-1R (Glp1r-cre/tdRFP) [16 (link), 71 (link)] were used to determine the expression of the receptor by the brain blood vessels. The animals were terminally anaesthetised with sodium pentobarbital overdose (200 mg kg−1; i.p.) and perfused through the heart with 0.01 M phosphate-buffered saline. The brains were removed and fixed overnight in 4% paraformaldehyde. Free-floating sections (20 µm thickness) were incubated (overnight at 4 °C) with anti-DsRed antibody (1:500) (Takara Bio) to detect GLP-1R expressing cells and anti-smooth muscle actin (SMA) antibody conjugated to FITC (1:350) (Sigma) for the detection of arteries and arterioles. Incubation with anti-rabbit AlexaFluor 568 (1:200, 2 h) was performed on the next day, followed by endothelial cell labelling using biotinylated lectin (1:250, 30 min) (Vector Biolabs), visualised using AMCA streptavidin (1:100, 1 h) (Vector Biolabs). Tiled images of coronal cortical cross-sections were obtained using Zeiss LSM 800 confocal microscope.
10
Viral Transduction Characterization in Avian Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To examine the efficacy in targeting and expression of viral injections, birds were perfused with warm saline followed by ice cold 4% paraformaldehyde in 0.1 mol/L phosphate buffer, and their brains extracted for histological analysis. Characterization of viral transfection was carried out using immunohistological methods described by Miller et al. (2008 ). AAV‐driven expression of mCherry required immunostaining with an anti‐dsRED antibody (#632496; Takara Bio USA Inc, Mountain View, CA) for visualization. HSV‐driven expression could typically be visualized without an immunostaining experiment (indicative of greater transduction levels than those achieved with AAV) but one was often done to boost native fluorescence. Brains were sectioned on a crysostat (Leica Microsystems, Bannockburn, IL) at a thickness of 30 μm.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!