The control and LKB1 knockout (KO) lines were generated by infecting the cell lines with lentivirus generated from the LentiCRISPRv2 plasmid (Addgene, 52961). The control and TPI1 KO or SIK KO lines were generated by infecting the Cas9-expressing lines (LentiCRISPRv2) with lentivirus generated from the LRT2B plasmid (Addgene, 110854). The sgRNA sequences were as follows: sgNT1, CCAATACGGACCGGATTGCT; sgLKB1-2, TGTATAACACATCCACCAGC; sgLKB1-3, TGCACAAGGACATCAAGCCG; sgSAFE, GGTTGGATAAGGCTTAGAAA; sgTPI1-3, GAAGTACACGAGAAGCTCCG; sgTPI1-4, GGAAGCCATCCACATCAGGC; sgSIK1, ATGGTCGTGACAGTACTCCA; sgSIK2, GCACCGGATCACCAAGACGG; sgSIK3, GTGCTTGCAGATCTGCTCCA; and sgTpi1, TGAAGGTCAGTACAAACGCA. The TPI1 alleles were synthesized by Twist Biosciences and cloned into pHAGE-CMV-N-Flag-HA-IRES-Puro-DEST or pLenti-PGK-Hygro via Gateway cloning or Gibson Assembly using NEB HiFi DNA Assembly Master Mix.
Lentivirus
Manufactured by Addgene
Lentivirus is a viral vector system used for gene delivery. It is capable of transducing both dividing and non-dividing cells, allowing for stable integration of the gene of interest into the target cell's genome.
Automatically generated - may contain errors
Lab products found in correlation
Lenticrispr v2, by Addgene (2 mentions)
Lenti x 293t, by Takara Bio (1 mentions)
Pmdlg prre, by Addgene (1 mentions)
Plasmid maxi kit, by Omega Bio-Tek (1 mentions)
Pmd2 g, by Addgene (1 mentions)
Prsv rev, by Addgene (1 mentions)
Hifi dna assembly master mix, by New England Biolabs (1 mentions)
Psp 108 vector, by Addgene (1 mentions)
Plko 1 vector, by Addgene (1 mentions)
5 protocols using lentivirus
1
CRISPR-Mediated Genetic Perturbation
2
Genetic Manipulation of Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The control and LKB1-KO lines were generated by infecting the cell lines with lentivirus generated from the LentiCRISPRv2 plasmid (Addgene: 52961). The control and TPI1-KO or SIK-KO lines were generated by infecting the Cas9-expressing lines (LentiCRISPRv2) with lentivirus generated from the LRT2B plasmid (Addgene: 110854). The sgRNA sequences are as follows: sgNT1, CCAATACGGACCGGATTGCT; sgLKB1-2, TGTATAACACATCCACCAGC; sgLKB1-3, TGCACAAGGACATCAAGCCG; sgSAFE, GGTTGGATAAGGCTTAGAAA; sgTPI1-3, GAAGTACACGAGAAGCTCCG; sgTPI1-4, GGAAGCCATCCACATCAGGC; sgSIK1, ATGGTCGTGACAGTACTCCA; sgSIK2, GCACCGGATCACCAAGACGG; sgSIK3, GTGCTTGCAGATCTGCTCCA. The TPI1 alleles were synthesized by Twist Biosciences and cloned into pHAGE-CMV-N-Flag-HA-IRES-Puro-DEST via Gateway cloning.
3
Lentiviral Antagomir-138 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stable expression of antagomiRs was carried out using miRZip, a lentiviral expression vector (System Biosciences). Mature functional antagomiR-138 sequence is CGGCCTGATTCACAACACCAGCT. The H1 expression cassette provides constitutive RNA polymerase III-dependent transcription of antagomiR transcripts. CMV promoter supports expression of copGFP (fluorescent reporter) and puromycin-N-acetyl transferase (drug-selectable marker) for detection and selection of transduced cells, respectively. Lentivirus expressing luciferase under human PGK promoter was obtained from Addgene. Adapted from Chan et al.23 (link). Third-generation Lentiviruses were produced in Lenti-X 293 T (Clontech) with packaging mix consisting of three constructs, pMDLg/pRRE (#12251), pRSV-Rev (#12253), and pMD2.G (#12259), from Addgene. Supercoiled DNA constructs were prepared using Plasmid Maxi Kit (Omega bio-tek).
4
Cloning and Viral Construct Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the gene open reading frames were amplified by RT‐PCR and verified by sequencing. Human Hdac plasmids were kindly provided by Dr. Qunying Lei, Fudan University. Construction and package of knockdown (Addgene, pSP‐108 vector), overexpressing lentivirus (Addgene, 17 398), and adenovirus (Addgene, 16 404) was followed the standard protocol. Lentiviral Cre construct was from addgene (#30 205).
5
Lentiviral HDAC6 Knockdown in Dental MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral expression vector was constructed using pLKO.1 vector (Addgene). The sequence for scramble (control) was 5’-CCTAAGGTTAAGTCGCCCTCG-3′. The target sequences for shRNA were HDAC6sh1, 5’-CATCCCATCCTGAATATCCTT-3′ and HDAC6sh2, 5’-GCACAGTCTTATGGATGGCTA-3′. The insert was subcloned into pLKO.1 using Agel and EcoRI sites. Lentivirus production was performed according to the protocol provided by Addgene. Forty-eight hours after the transfection, the media containing viruses were collected and concentrated by ultracentrifugation.
Dental MSCs were seeded overnight and then infected with Lentivirus in the presence of polyybrene (6 μg/mL; Sigma-Aldrich) for 24 h. The cells were then selected with puromycin for 72 h. Puromycin-resistant clones were cultured, and HDAC6 expression was detected by real-time RT-PCR. In rescue experiments, HDAC6-knockdown dental MSCs were infected with adenovirus (Sigma-Aldrich, St. Louis, MO, USA) containing flag-tagged HDAC6.
Dental MSCs were seeded overnight and then infected with Lentivirus in the presence of polyybrene (6 μg/mL; Sigma-Aldrich) for 24 h. The cells were then selected with puromycin for 72 h. Puromycin-resistant clones were cultured, and HDAC6 expression was detected by real-time RT-PCR. In rescue experiments, HDAC6-knockdown dental MSCs were infected with adenovirus (Sigma-Aldrich, St. Louis, MO, USA) containing flag-tagged HDAC6.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!