D9542 10mg

To validate the primary cells, cells were fixed with 4% paraformaldehyde (Biosesang, Korea) for 10 min at room temperature, permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, St. Louis, MO, USA) in Dulbecco’s phosphate-buffered saline (DPBS; Welgene) for 30 min at room temperature, and then washed three times with DPBS. The following primary antibodies were used: goat monoclonal anti-human serum albumin (A80-229A, 1:250, Bethyl laboratories, TX, USA), mouse monoclonal anti-human Hep-Par 1(OCH1E5, 1:250, Cell Marque, Darmstadt, Germany), and mouse monoclonal anti-alpha fetoprotein (ab3980, 1:250, abcam, Waltham, MA, USA). Samples were incubated with the primary antibodies for 16 h at 4 °C and then washed for 10 min three times with DPBS. The secondary antibodies used for staining were donkey anti-mouse IgG conjugated with Alexa^® Fluor 488 (A-21202, Invitrogen, Eugene, OR, USA) and donkey anti-goat IgG conjugated with Alexa^® Fluor 647 (A32849, Invitrogen). Samples were then incubated with secondary antibodies for 1 h at room temperature in the dark and washed for 10 min five times with DPBS. For nuclei staining, cells were incubated with DAPI (D9542-10MG, Sigma-Aldrich, St.Louis, MO, USA) for 10 min at room temperature in the dark and washed with PBS twice quickly. All fluorescence images were obtained using the LSM 700 (Zeiss, Oberkochen, Germany).

HaCaTs were plated at 60,000 cells per well on glass coverslips in 24-well plates. The following day, cells were treated and transfected as described above. For mitotic sync experiments: HaCaTs were synchronized to prometaphase as described above. For all experiments, after transfection, cells were fixed with 2% paraformaldehyde/PBS for 10 min at RT and permeabilized with 0.2% Triton X-100/PBS for 10 min at RT. Samples were blocked in 4% BSA/1% goat serum/PBS overnight at 4°C. Rabbit polyclonal anti-TGN46 (T7576. 1:500; Sigma-Aldrich), mouse monoclonal anti-p230 (611280, 1:500; BD Biosciences), mouse monoclonal anti-IRF3 (ab50772, 1:100; Abcam), rabbit anti-cGAS (15102, 1:100; Cell Signaling), and rabbit monoclonal anti-STING (ab181125, 1:500; Abcam) were used as primary antibodies. Alexa Fluor–488, Alexa Fluor–555, and Alexa Fluor–647 labeled goat antimouse and goat antirabbit secondary antibodies (A11029, A21424, A21429, and A21236; Life Technologies) were used at 1:1,000. Samples were then stained with 4′,6-diamidino-2-phenylindole (DAPI) (D9542-10MG; Sigma-Aldrich) at 1 μg/ml for 30 s. Coverslips were mounted on glass slides with Prolong Antifade Diamond (P36970; Life Technologies) and analyzed by confocal microscopy.

After destaining the phenotypic probes, the cells were incubated with a sequencing primer (CACCTCATCCCACTCTTCAAAAGGACGAAACA CCG) at 1 μM concentration in 2X SSC with 10% formamide for 30 minutes at room temperature. Following this primer hybridization, the cells were washed three times with PR2 buffer (Nano kit PR2) and then incubated with incorporation mix (Nano kit reagent 1) for five minutes at 60°C. The incorporation mix was then removed over six serial dilutions with PR2 buffer. In order to decrease background fluorescence, the cells were washed with fresh PR2 buffer and incubated at 60°C for five minutes. The washing process was repeated five times before adding 200 ng/mL DAPI (Sigma-Aldrich #D9542–10MG) in 2X SSC and imaging.