Mytaq master mix

C57BL6/J females were superovulated and crossed with CAST/EiJ males. Zygotes were recovered the next day and electroporated with two sgRNAs for the Gab1 RLTR15 ERVK element (200 ng/μL each) (Additional file 1: Figure S7) and CAS9 protein (500 ng/μL). Embryos were then implanted into NMRI pseudo-pregnant females. The embryos were dissected on E12.5, and the following tissues were collected: (1) visceral yolk sac/amnion, (2) placental disc with as much decidua removed as possible, (3) embryo, and (4) tail clip for genotyping. Tissue samples were washed in cold PBS and flash-frozen in 50 μL of RLT+ buffer (Qiagen). Tissues were collected from a total of 42 E12.5 embryos from 6 females across 2 independent experiments.
DNA from tail clippings were genotyped using MyTaq master mix (Bioline) with primers: F - AGCCCAATCTCACAACAGTT, R - CGGACCAGGTGAACATGTTG. Bands corresponding to the wild-type (847 bp) and knockout (320 bp) alleles were gel extracted and sent for Sanger sequencing to identify the targeted allele (Additional file 1: Figure S7). One effectively targeted sample (F4E5) and three wild-type controls (F4E1, F4E3, and F5E6) were selected for RNA sequencing.

Overnight cultures of wild-type C. jejuni and C. jejunipglB::aphA were diluted to an OD₆₀₀ of 0.1 and then incubated in the VAIN at 37°C under shaking conditions. At an OD₆₀₀ of 0.4 to 0.5, cells were harvested, and RNA was extracted by using a Monarch total RNA extraction kit (New England Biolabs) following the manufacturer’s protocol. The extracted RNA (2 μg) was treated with Ambion Turbo DNase (Invitrogen) according to the manufacturer’s instructions. cDNA was generated using Superscript III kit (Invitrogen) from DNase-treated RNA. cDNA and DNase-treated RNA were used as the templates in PCR using MyTaq mastermix (Bioline, UK) using the pglA, pglJ, and pglC oligonucleotide primers in Table 1.

An overnight culture of A. pleuropneumoniae HS143 was diluted 1 : 20 in BHI–NAD broth. At the time points of 1.5, 3.0, 5 and 24 h, RNA was extracted as previously described [29 (link)], with the minor modification that 2 µg of total RNA from each sample was treated with Ambion TURBO DNase (Invitrogen) according to the manufacturer's instructions. cDNA was generated from DNase-treated RNA using the SuperScript II kit (Invitrogen) according to the manufacturer's instructions. For each sample, 2 µl of reverse transcribed cDNA was used as a template in a 25 µl total volume PCR mixture and amplified using MyTaq master mix (Bioline, UK) using the following cycling conditions: 94°C/30 s, followed by 35 cycles of 94°C/10 s, 53°C/10 s, 72°C/10 s and a final single 72°C/30 s cycle using the primers listed in electronic supplementary material, table S2.