5′ RACE was used to obtain the missing leader sequence (52 bp). The SMARTer 5′ RACE and 3′ RACE kit (Takarabio) was used according to the kit instructions. The gene specific primer used for 5′ RACE was TCAGCTACAGTAGAGGGAGATGTCATAGGTGC. For Sanger sequencing, amplicons was performed using KAPA HiFi HotStart ReadyMixPCR Kit (KAPABiosystems). The primers CTAAAGAGAAGGTGGACACTGGT and CTAAGAATGCGAACTTCACAGAGC were used to amplify the gene 4b homologue region. The primers GTTGTTGTGTTACAAGGCAAGGG and GGATTATGATCAAACCATGAACCTGG were used to amplify the NSP 10/12 region. Cycling conditions used to generate amplicon for Sanger sequencing were: 1 cycle: 95 °C for 3 minutes, 40 cycles: 98 °C for 20 seconds, 65 °C for 15 seconds, 72 °C for 2.5 minutes, and 1 cycle: 72 °C for 3 minutes. Amplicons were cleaned using AMPure XP beads (Beckman Coulter) according to the manufacturer’s directions. Sanger sequencing was performed on the ABI Genetic Analyzer 3130XL platform using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the user manual.
Smarter 5 race and 3 race kit
Manufactured by Takara Bio
The SMARTer 5' RACE and 3' RACE kit is a tool for rapid amplification of cDNA ends. It is designed to efficiently generate full-length cDNA sequences from RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using smarter 5 race and 3 race kit
1
SARS-CoV-2 Gene Amplification and Sequencing
2
5′RACE for Metabolic Gene Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5′RACE experiments were performed using a Takara Bio SMARTer 5′RACE and 3′RACE Kit according to manufacturer guidelines. Briefly, PHTs were isolated from E10.5 mouse embryos and snap frozen in liquid nitrogen before being stored at −80°C. 1FF2FF and Nkx2.5;1KO2KO total RNA was isolated using a Qiagen RNeasy Plus Micro Kit from pools of three biologically independent samples (n = 3), and first-strand cDNA was synthesized using reagents and protocols provided by the kit. Using primers complementary to sequences in distal exons of key metabolic genes (below) and reagents provided in the kit, 5′RACE was performed. Products were resolved in a 1% tris-acetate-EDTA (TAE)/ethidium bromide gel, extracted using a QIAquick Gel Extraction Kit (Qiagen), and sequenced (Eurofins Genomics). Specificity and alignment of sequences were determined using MacVector. Primer sequences are included in the Supplementary Materials.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!