Vigofect

The ASK1 shRNA and scrambled shRNA were purchased from Santa Cruz Biotechnologies (Santa Cruz Biotechnologies, Dallas, Texas, USA). The ASK1 shRNA Plasmid (h) is a pool of 3 different shRNA plasmids with the following hairpin sequences: GATCCGTACCTCAAGTCTATTGTATTCAAGAGATACAATAGACTTGAGGTACTTTTT, GATCCCAAGGCATTCATACTGAAATTCAAGAGATTTCAGTATGAATGCCTTGTTTTT, and GATCCGGAAGGCTATCATTGACTTTTCAAGAGAAAGTCAATGATAGCCTTCCTTTTT. All sequences are provided in 5′→3′ orientation. shRNA was transfected into cells using VigoFect (Vigorous Biotechnology, PRC) following protocols provided by the manufacturer. Briefly, 2 × 10⁵ cells were seeded into six-well plates and grown to 40–60% confluence. The medium was renewed 1 h before transfection. The mixture of 10 μl of shRNA (1 μg) diluted in 90 μl of normal saline and 1 μl of VigoFect diluted in 99 μl of normal saline was added dropwise to the medium. At 48 h post-transfection, the medium was replaced with fresh selective medium containing 1 μg/mL puromycin (Santa Cruz Biotechnologies) to screen for stably transfected cells. The cultures were replaced with fresh selective medium every two days until no cells were killed.

Pseudoviruses were produced in HEK293T cells by co-transfecting the retroviral vector pTG-MLV-Fluc, pTG-MLV-Gag-pol, and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G, Addgene #12259) using VigoFect (Vigorous Biotechnology). At 48 h post transfection, the cell culture medium was collected for centrifugation at 3500 rpm for 10 min, and then the supernatant was subsequently aliquoted and stored at -80°C for further use. Virus entry was assessed by transduction of pseudoviruses in A549 cells expressing ACE2 orthologs or mutants in 48-well plates. After 48 h, intracellular luciferase activity was determined using the Luciferase Assay System (Promega, Cat. #E1500) according to the manufacturer’s instructions. Luminescence was recorded on a GloMax Discover System (Promega).

Coronavirus PsVs were produced as previously reported. Briefly, HEK293T cells were seeded in a 6-well plate 24 h before transfection. Upon transfection, HIV backbone plasmid (pNL4-3.Luc.R-E) and spike-expressing plasmid, such as pcDNA3.1-SARS-CoV-2-spike, were co-transfected into HEK293T cells by Vigofect (Vigorous Biotechnology, Beijing, China). At 10 h post-transfection, cellular supernatants containing transfection reagent were changed for fresh DMEM containing 5% FBS. After another 36–48 h culture, cell supernatants containing PsV particles were collected and stored at −80 °C.

Lenticrispr-v2 (AddgenePlasmid49535, Feng Zhang) plasmids were purchased, and the sgRNA online design tool (http://crispr.mit.edu/) was used to design sgRNA targeting Sidt2. The primer sequences were as follows: F: 5′-ACCACACCGTGACCC CAC-3′, R: 5′-GTTGCGGGTCACTGGTGT-3′, synthesized by biotechnology company (Sangon Biotech, Shanghai, CHN). Using the CRISPR/Cas9 lentivirus system, the Lenticrispr-v2 plasmid was linearized and linked to the annealed sgRNA duplex to construct the Lenticrispr-v2-Sidt2 recombinant plasmid. Vigofect (Vigorous Biotechnology, Beijing, CHN) transfection reagent was used to transfect the Lenticrispr-v2 plasmid and Lenticrispr-v2-Sidt2 recombinant plasmid in order to construct the lentivirus. The obtained lentivirus was transfected into the MPC5 cells and SV40 MES 13 cells. After 48 h, the cells were incubated with purinomycin for 72 h to selection. The surviving cells were the Sidt2^+/+ group and Sidt2^−/− group that had been successfully transfected.

As shown in Section 2.2.1, the H-Fe and H fragments were amplified via fusion PCR and cloned into the pVL1393 vector to obtain pVL1393-H-Fe and pVL1393-H. Then, they were cloned into the pBmPH vector to construct the transfer vector pBmPH-H-Fe. Then, the transfer vectors were co-transfected (VigoFect was purchased from Vigorous Biotechnology Beijing Co., Ltd., Beijing, China) with reBmBac into BmN cells. Finally, the recombinant BmNPV baculovirus reBm-H-Ferritin and reBm-H were obtained from the supernatant of co-transfected cells. The recombinant viruses reBm-H-Ferritin and reBm-H obtained via co-transfection were used as the starting stocks for mono plaque purification, and the highly expressed strains were selected for amplification, which were used as the parent strains of the virus for further experiments.

The coding sequence of mCherry was cloned and inserted into the FUGW vector to generate the FUGW-mCherry vector. FUGW-mCherry vector was extracted and purified using an EndoFree Plasmid kit (CoWin Biotech Co., Beijing, China). For the generation of lentivirus, 293T cells were transfected with individual vectors combined with psPAX2 and pMD2.G packaging plasmids (5:3:2) using Vigofect (Vigorous Biotechnology Beijing Co., Ltd.). The supernatants containing the virus were collected after 48 h, filtered through a 0.45 mm filter (Merck Millipore), and concentrated by PEG-8000 according to the standard protocols. After concentration, the viruses were resuspended in the corresponding medium, and 2 × 10⁴ mESCs were infected. After 8–10 h viral infection, the cells were washed with PBS and cultured using fresh media. PCR was used to detect exogenous gene integration. mCherry-labeled mESCs could be purified by MoFlo XDP cell sorter (Beckman Coulter).

Vero cells and HEK293T cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (HyClone) containing 10% fetal bovine serum (FBS) and 5% penicillin-streptomycin solution (HyClone). IPEC-J2 cells were maintained in DMEM-F12 (HyClone) supplemented with 10% FBS and 5% penicillin-streptomycin solution. When cells seeded in culture plates grew to approximately 60%, they were transfected with plasmids using VigoFect (Vigorous Biotechnology) or Lipo8000 transfection reagent (Beyotime, Shanghai, China) according to the manufacturer’s instructions. Porcine small intestinal crypts were isolated from 3-week-old healthy Yorkshire piglets, and the crypts were seeded in a 48-well plate to culture porcine intestinal enteroids (PIEs) as described in our previous protocol (58 (link)). The animal study was reviewed and approved by the Animal Care and Use Committee of Zhejiang University.
The PEDV strain ZJ15XS0101 (GenBank accession no. KX55SO0281) was isolated and stored in our laboratory (59 (link)). Vero cells and IPEC-J2 cells grown to approximately 80% to 90% in cell culture plates were infected with PEDV at different multiplicities of infection (MOI) with 4 μg/ml trypsin.