Hap1 isogenic cell lines

Original cell lines were acquired from the ATCC, ECACC, and JCRB. HAP1 isogenic cell lines were purchased from Horizon Discovery. All cell line stocks were routinely tested for Mycoplasma. HAP1, LN229, YKG1, KNS60, U118MG, H4, LN18, T98G, YH13, KS1, KALS1, and SW1088 were maintained in DMEM supplemented with 10% FBS and 1% sodium pyruvate. U251MG cell lines were maintained in EMEM supplemented with 10% FBS. All cell lines were maintained in a cell culture incubator at 37°C, 95% humidified air, and 5% CO₂ atmosphere. GBM patient-derived xenograft (PDX) models were passaged in immune-deficient NSG mice, dissociated, and then injected into the flank of female NSG mice. Xenograft tumors were dissociated using a papain dissociation kit to obtain cancer stem cell (CSC) and non-CSC tumor fractions, cultured in supplemented neurobasal medium, and then sorted on the basis of CD133 status. CD122⁺ (CSC) cells were maintained in supplemented neurobasal medium, and CD133⁻ (non-CSC) cells were maintained in DMEM supplemented with 10% FBS and 1% pen/strep. For detailed information see Supplementary Methods.

Human haploid (HAP1) isogenic cell lines were obtained from Horizon Discovery. The cells were either wild-type HAP1 (RRID: CVCL_Y019) or gene edited for SLC30A10 (HZGHC004693c005, RRID: CVCL_TM87), PARK2 (HZGHC003208c002, RRID: CVCL_TC07), SLC25A4 (HZGHC000778c011, RRID: CVCL_TM45), FASTKD2 (HZGHC006859c004, HZGHC006859c007 RRID: CVCL_B5J3 and CVCL_B5J4) or DHX30 (HZGHC007945c004 RRID: CVCL_B5J6). Cell lines were maintained in IMDM (Lonza Walkersville, 12-722F) supplemented with 10% fetal bovine serum (FBS) and 100 µg/ml penicillin and streptomycin. The cell cultures were grown at 37°C in a 10% CO₂ incubator. Manganese-resistant HAP1 cells were obtained by incubating wild-type HAP1 cells in 150 µM manganese until cell death ceased for 5 d and then grown in regular media. Human neuroblastoma SH-SY5Y cells (American Type Culture Collection; CRL-2266; RRID: CVCL_0019) were grown in DMEM containing 10% FBS at 37°C in 10% CO₂. SH-SY5Y deficient in SLC30A10 were genome edited using gRNA and Cas9 preassembled complexes by Synthego with a knockout efficiency of 98%. The gRNAs used was GCAGCGCGAUGGAGUUGCCC, which targeted transcript ENST00000366926.3 exon 1. Wild-type and mutant cells were cloned by clonal dilution, and mutagenesis was confirmed by Sanger sequencing with the primer 5′GAGACAATCTGGGAGGCGG.