Nebnext high fidelity 2x pcr master mix
The NEBNext High-Fidelity 2X PCR Master Mix is a pre-mixed, ready-to-use solution designed for high-fidelity PCR amplification. It contains a high-performance DNA polymerase, buffer, and dNTPs optimized for accurate and efficient amplification.
Lab products found in correlation
127 protocols using nebnext high fidelity 2x pcr master mix
Overexpression of Sorghum SbKOR1 in Arabidopsis
Two-step PCR for Illumina Library Prep
High-Fidelity PCR Amplification of DNA
ATAC-seq Library Preparation from Sorted Cells
Tn5 Transposition and Library Preparation
Read1 - TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Read2 - /5Phos/GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
Reverse - /5Phos/C*T*G*T*C*T*C*T*T*A*T*A*C*A*/3ddC/
Nuclei were isolated from 50,000 cells, followed immediately by transposition at 37 oC for 30 min. Transposed DNA fragments were purified using a Qiagen MinElute Kit, barcoded with primers based on Illumina TruSeq indices, and PCR amplified for 5 cycles using NEBNext High Fidelity 2x PCR master mix (NEB). Libraries were column-purified with the Qiagen PCR Cleanup kit, followed by 1.0x AMPure bead cleanup. Library quality was assessed on 4200 TapeStation (Agilent), and concentrations were quantified by Qubit D1000 assay (ThermoFisher Scientific). Samples were sequenced using 150-cycle High Output NextSeq kits (Illumina, 20024907) to generate 75 bp paired end reads.
RNA Isolation and Sequencing Library Preparation
Yeast Genome Sequencing using Nextera
Yeast Genome Sequencing using Nextera
Measuring Cas9 and Q Gene Expression
High-Fidelity PCR Assembly Optimization
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!