Genomic sequences CL529183, CL529481 and CL528939 [11 (link)] and DX598014 [10 (link)] of 1.2 kb and containing HIV integration sites identified in vivo were amplified from a genomic DNA library (Invitrogen), and cloned into the Xho I / Cla I sites of the plasmid pBSK-zeo. DNA fragments were generated by Xho I / Cla I restriction digest or by PCR using primers pBSK-zeo 5’ (GTAATACGACTCACTATAGGGCG) and pBSK-zeo 3’ (AAGCGCGCAATTAACCCTCAC) and purified from agarose gel using a Wizard column (Promega). DNA fragments were chromatinized using purified HeLa core histones, and a NaCl gradient dialysis protocol [55 (link), 56 (link)]. Different ratios of histone to DNA (μg/μg) were used to produce different levels of nucleosome coverage. The ratios used in this study were low ratio (0.37/1, calculated to give two nucleosomes on 1.2 kb), medium ratio (0.74/1, calculated to give four nucleosomes on 1.2 kb) and high ratio (1.3/1, calculated to be in excess of histones for the maximum nucleosome coverage of 1.2 kb).
Wizard column
Manufactured by Promega
Sourced in United States
The Wizard column is a laboratory equipment designed for DNA purification. It functions by providing a simple and efficient means to isolate and concentrate DNA samples from various sources, such as PCR reactions, restriction digests, or plasmid preparations.
Automatically generated - may contain errors
8 protocols using wizard column
1
Chromatin Formation of HIV Integration Sites
2
Efficient HIV Integration Assay Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The IN-LEDGF/p75 protein complex was a gift from Marc Ruff, IGBMC, Strasbourg [20 (link)]. IN enzyme and LEDGF/p75 cofactor were purified as previously described [37 (link), 57 (link)]. Two integration protocols were tested. The first protocol was adapted from [58 (link)] with minor changes. Briefly, reactions were conducted in 20–50ul reaction volume containing 100 mM NaCl, 20 mM Hepes pH 7.4, 12% DMSO, 10 mM DTT, 10 mM MgCl2, 20 μM ZnCl2. 10 nM of SupF pre-processed donor (generated by Nde I enzyme digestion) was added to IN alone (equivalent 600 nM monomer) or to the IN-LEDGF/p75 complex (equivalent 200 nM monomer) and incubated on ice for 30 min. 4 nM of acceptor DNA was added for a further 30 min on ice, then the reaction was shifted to 37°C for 1 hour. Reaction was stopped by the addition of 0.1% SDS, 1 mg/ml BSA, 10 mM EDTA and 1 μg/μl PNK enzyme. Integration products were then purified on a Wizard column (Promega). The second integration protocol has been previously described [27 (link)].
3
Amplifying Retroviral Integration Sites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 5’ and 3’ pBSK-zeo primers, and U3 (TGGAAGGGCTAATTCACTTAACG) and U5 (ccgctgtggaaaatctctagca) primers targeting SupF were used to amplify integration sites. An alternative U3 primer (cggtcgcgcaattctttcggac) was selected for the DX014 sequence to avoid non-specific priming. Integration products were used as a template in 20 μl PCR reaction using 4 primer combinations (5’ pBSK-zeo/U5, 5’ pBSK-zeo/U3, 3’ pBSK-zeo/U5, 3’ pBSK-zeo/U3). PCR products were pooled and purified on a Wizard column (Promega).
4
Mononucleosome Isolation and Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reconstituted chromatin was digested with 0.008 U/mL of MNase, 20mM of NaCl and 30 mM CaCl2, for 3 min at 28°C. This MNase concentration was selected from a concentration gradient tested to produce a mononucleosome band without overdigestion. Reactions were stopped by adding EDTA to a final concentration of 20 mM. Samples were then treated with 1 μl PNK enzyme (New England Biolabs) for 1 hour at 37°C, and digested DNA was separated on agarose gel. The band corresponding to the mononucleosome was excised from the gel. For the DNA alone control, double quantity of DNA was digested compared to the polynucleosome sample, and from the resulting DNA smear a fraction migrating between 100–300 bp was excised from the gel. DNA was purified on a Wizard column (Promega).
5
Viral DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For initial PCR-based analysis of PolB, we extracted viral DNA using Wizard columns (Promega, USA). For genome sequencing, 5 ml of each of the three viral stocks was filtered onto 0.1 µm, 45 mm Supor filters (Pall Scientific, USA) and flash-frozen in liquid nitrogen. This material was extracted using a modified CTAB protocol [15 (link), 43 (link)] designed to maximise the capture of unfragmented DNA molecules. DNA was quantified using a Qubit with the dsDNA HS Assay kit (Invitrogen, USA).
6
Molecular Identification of Ascochyta rabiei
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The obtained fragments with TP6-F/TP9-R specific primers of A. rabiei OS-8 colony, a symptomatic plant artificially infected of greenhouse assay and another of field randomly chosen, were purified via Wizard® columns (Promega, USA) and were sent to SICVyA (Unidad Genómica, Instituto de Biotecnología-INTA, Argentina) for sequencing using TP6-F/TP9-R primers. Analysis of the sequences obtained were performed using the BLASTN algorithm (Altschul et al., 1990 (link)) and compared with the GenBank database using the BLAST search program (http://www.ncbi.nlm.nih.gov/BLAST). The consensus sequences were assembled using the Staden program package (Staden et al., 2000) (link), and deposited in the GenBank (NCBI/EMBL) database.
7
Latent Period of PgV-14T and Gezel-14T
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A mixed lysate containing PgV-14T and Gezel-14T was diluted by 5×10 -5 to ensure one viral particle per 10 µl and used to infect 380 aliquots of P. globosa cultures in 96-well plates (200 µl) and incubated for 10 days. Lysed cultures were checked for Gezel-14T presence by PCR.
PgV-14T and Gezel-14T growth curve experiments. Experimental results for this and the experiments described below can be found in Supplementary File 1. To measure the latent period of PgV-14T and Gezel-14T we used a PgV-14T/P. globosa ratio of 0.1 (counted by FACS), and a PgV-14T/Gezel-14T ratio of 1 (calculated by qPCR). Experiments were performed in 25 ml of P. globosa cultures. At every sampling point (0, 2, 4, 6, 8, 9 and 10 hrs post infection) 2 ml culture was filtered through a 0.45 µm filter (Millex, SLHV033RS, Millipore) and the filtrate was kept at 4°C until analysis (for a maximum of 2 weeks). Samples were treated with DNAse (as described above), DNA was extracted using the Promega Wizard columns as described elsewhere 47 (link) , and quantified by qPCR (as described below). PgV-14T fixed particles were also counted by Cytek Aurora Flow Cytometer as described elsewhere 55 . We considered the latent phase finished when the free viruses reached 1.3 times the free viruses at 0 hrs. n = 5. (Supplementary File 1, "Infection's latent period").
PgV-14T and Gezel-14T growth curve experiments. Experimental results for this and the experiments described below can be found in Supplementary File 1. To measure the latent period of PgV-14T and Gezel-14T we used a PgV-14T/P. globosa ratio of 0.1 (counted by FACS), and a PgV-14T/Gezel-14T ratio of 1 (calculated by qPCR). Experiments were performed in 25 ml of P. globosa cultures. At every sampling point (0, 2, 4, 6, 8, 9 and 10 hrs post infection) 2 ml culture was filtered through a 0.45 µm filter (Millex, SLHV033RS, Millipore) and the filtrate was kept at 4°C until analysis (for a maximum of 2 weeks). Samples were treated with DNAse (as described above), DNA was extracted using the Promega Wizard columns as described elsewhere 47 (link) , and quantified by qPCR (as described below). PgV-14T fixed particles were also counted by Cytek Aurora Flow Cytometer as described elsewhere 55 . We considered the latent phase finished when the free viruses reached 1.3 times the free viruses at 0 hrs. n = 5. (Supplementary File 1, "Infection's latent period").
8
Molecular Identification of Ascochyta rabiei
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The obtained fragments with TP6-F/TP9-R specific primers of A. rabiei OS-8 colony, a symptomatic plant artificially infected of greenhouse assay and another of field randomly chosen, were purified via Wizard® columns (Promega, USA) and were sent to SICVyA (Unidad Genómica, Instituto de Biotecnología-INTA, Argentina) for sequencing using TP6-F/TP9-R primers. Analysis of the sequences obtained were performed using the BLASTN algorithm (Altschul et al., 1990 (link)) and compared with the GenBank database using the BLAST search program (http://www.ncbi.nlm.nih.gov/BLAST). The consensus sequences were assembled using the Staden program package (Staden et al., 2000) (link), and deposited in the GenBank (NCBI/EMBL) database.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!