Platinum pfx dna polymerase

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, United Kingdom

Platinum Pfx DNA polymerase is a high-fidelity DNA polymerase enzyme used for accurate DNA amplification in PCR applications. It offers robust performance and exhibits 3'->5' exonuclease proofreading activity to ensure precise DNA replication.

Automatically generated - may contain errors

Lab products found in correlation

141 protocols using platinum pfx dna polymerase

PCR Amplification and Sequencing of M-F UTR

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplification of M-F UTR was performed using Platinum Pfx DNA polymerase (Thermo Fisher Scientific) and primer pairs (a) M7 and M6 (5′-CCGTCTTGGATTGTCGATG-3′); and (b) F9 (5′-GGCCAAGGAACATACACA-3′) and F16 (5′-ATTGATGGCTGGAACGAGTC-3′). Reaction mixtures included 25 μL of cDNA (total reverse transcription mixture), 1× Pfx amplification buffer (Thermo Fisher Scientific), 3× PCRx Enhancer Solution (Thermo Fisher Scientific), 30 nmol of each dNTP, 0.1 μmol MgSO₄, 30 pmol of each primer and 1 U of Platinum Pfx DNA polymerase in a total volume of 100 μL. After the initial denaturation step at 94 °C for 5 min, 45 cycles at 94 °C for 30 s, 50 °C for 30 s and 72 °C for 1 min were performed, followed by a terminal elongation step at 72 °C for 10 min.
Purified PCR products were sequenced on ABI PRISM 3130 Genetic Analyzer (Thermo Fisher Scientific), according to manufacturer’s instructions. Nucleotide sequences were deposited in GenBank under acc. nos. KF515521 and KF515522.

Ivancic-Jelecki J., Slovic A., Šantak M., Tešović G, & Forcic D. (2016). Common position of indels that cause deviations from canonical genome organization in different measles virus strains. Virology Journal, 13, 134.

+ Open protocol

+ Expand

Molecular Cloning and Purification of Key Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human SFXN1 cDNA was amplified from HEK293 mRNA by using GoScript^™ Reverse Transcription Mix, Oligo(dT) (Promega). Human AGK was copied from HeLa cDNA. CNAP-SFXN1, SFXN1-HA, and AGK^G126E were generated by overlap-extension polymerase chain reaction (PCR) using Platinum^™Pfx DNA polymerase (Thermo Fisher Scientific). All were cloned into pcDNA5/FRT (Invitrogen) and sequenced before use for transfection. To purify recombinant AGK and recombinant ANT2, human AGK and ANT2 were cloned into pET28a vector (Novagen) containing a N-terminal hexahistidine tag. Protein induction, extraction and affinity purification were carried out as described previously (Lu et al., 2017 (link)).

Acoba M.G., Alpergin E.S., Renuse S., Fernández-del-Río L., Lu Y.W., Khalimonchuk O., Clarke C.F., Pandey A., Wolfgang M.J, & Claypool S.M. (2021). The mitochondrial carrier SFXN1 is critical for complex III integrity and cellular metabolism. Cell reports, 34(11), 108869.

+ Open protocol

+ Expand

Knockdown and Overexpression of SLX4IP

Check if the same lab product or an alternative is used in the 5 most similar protocols

SLX4IP knockdown was achieved by VSV-G lentiviral transduction of pLKO.1 containing either a nonspecific shRNA sequence or one of two gene-specific sequences (GE Dharmacon; Table S1). Telomerase-positive D2.OR cells were transduced with vectors harboring a chimeric single guide RNA scaffold (pLentiCRISPRv2) (Shalem et al, 2014 (link)), followed by selection with puromycin (5 μg/ml). Single guide RNA design was carried out using CHOPCHOP (Labun et al, 2016 (link)). Stable overexpression of SLX4IP was accomplished via transduction with pLenti CMV GFP expressing, FLAG-tagged, RNAi-resistant SLX4IP (pLenti-SLX4IP). SLX4IP cDNA was PCR-amplified using Platinum Pfx DNA Polymerase (Thermo Fisher Scientific) and purified using the QIAquick PCR Purification Kit (QIAGEN), digested with Sal I and EcoRV (New England Biolabs), and ligated into pENTR4-FLAG (QIAquick Gel Extraction Kit; QIAGEN). Generation of the overexpression construct was carried out using the Gateway LR Clonase II system (Thermo Fisher Scientific).

Table S1 Sequences of shRNAs and CRISPR constructs.

Robinson N.J., Morrison-Smith C.D., Gooding A.J., Schiemann B.J., Jackson M.W., Taylor D.J, & Schiemann W.P. (2020). SLX4IP and telomere dynamics dictate breast cancer metastasis and therapeutic responsiveness. Life Science Alliance, 3(4), e201900427.

+ Open protocol

+ Expand

Heterologous Expression of PA3177 in E. coli and P. aeruginosa

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cloning procedures were performed with E. coli strain DH5α, proof-reading Platinum^®pfx DNA polymerase and restriction enzymes from Thermo Fisher Scientific (St. Leon-Rot, Germany) according to standard protocols provided by the manufacturers. Primer sequences for subsequent cloning experiments are shown in Supplementary Table S1.
For overexpression in P. aeruginosa, ORF PA3177 was amplified from PAO1 genomic DNA using a XbaI restriction site flanked forward primer and a SacI site flanked reverse primer and the fragment was cloned into the arabinose-inducible broad host range vector pJN105 (Newman and Fuqua, 1999 (link)), resulting in pJN3177.
For overexpression in E. coli BL21 (DE3), ORF PA3177 was amplified from PAO1 genomic DNA using a BamHI restriction site flanked forward primer and a XhoI site flanked reverse primer followed by in-frame insertion into pET-23a(+) (Novagen, Merck, Darmstadt, Germany). The resulting plasmid pET3177 and the vector control pET23a were then transferred into E. coli strain BL21 (DE3) by heat shock transformation (Hanahan, 1983 (link)). E. coli was chosen for the heterologous expression of PA3177 due to its fast growth to high cell densities and the availability of highly efficient and tightly regulated gene expression systems.

Strempel N., Nusser M., Neidig A., Brenner-Weiss G, & Overhage J. (2017). The Oxidative Stress Agent Hypochlorite Stimulates c-di-GMP Synthesis and Biofilm Formation in Pseudomonas aeruginosa. Frontiers in Microbiology, 8, 2311.

+ Open protocol

+ Expand

BGISEQ-500 Library Preparation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Our
second-step PCR was undifferentiated amplification, and the
ends of the amplified products were the adapter sequences of BGISEQ-500,
wherein the sequences of adapter 1 and adapter 2 were “GAACGACATGGCTACGATCCGACTT”
and “TGTGAGCCAAGGAGTTG****TTGTCTTCCTAAGACCGCTTGGCCTCCGACTT”,
respectively. **** is the barcode sequence of BGISEQ to distinguish
between different samples. Barcode details of the BGISEQ sequencer
can be viewed in the Supporting Information 4, with a total of 128 different barcode sequences (approximately
10 bp) used. Based on the DNB technology, a single strand of DNA containing
hydroxyl and phosphoric acid is required for the subsequent step of
DNA cyclization. Therefore, the first base at the 5′ end of
adapter 1 was phosphorylated.
The second-step PCR system contained
a purified product after the first-step PCR, 3 μL of the Adapter
Mix, 10 μL of the 1× PCR buffer (Nuhighbio, Suzhou, China),
1 U of NH9007 the DNA polymerase (Nuhighbio, Suzhou, China), and 0.2
U of the Platinum Pfx DNA polymerase (ThermoFisher Scientific, MA).
The reaction conditions of the second-step PCR designed here are shown
in Table 6.
To protect the 5′-terminal phosphoric acid, the buffer of
the second-step PCR was alkaline (pH > 8.0), which is NH9719. In
addition,
we replaced nuclease-free water with the Tris–EDTA (TE) buffer
(ThermoFisher Scientific, MA), which maintained alkalinity.

Miao X., Li B., Shen Y., Yu H., Zhu G., Liang C., Fu X., Wang C., Li S, & Zhang B. (2020). Development and Verification of an Economical Method of Custom Target Library Construction. ACS Omega, 5(22), 13087-13095.

+ Open protocol

+ Expand

Fungal DNA Extraction and Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

For DNA extraction, isolates were grown in potato dextrose broth for 1 day. Mycelia were then harvested and washed with sterilized water. Genomic DNA was extracted using a previously published protocol (Saitoh et al., 2006 (link)). The primers ITS1F (5′-TCCGTAGGTGAA CCTGCGG-3′) and ITS4R (5′-TCCTCCGCT TATTGATATGC-3′) were used to amplify the ITS (internal transcribed spacer) region (White et al., 1990 ). Primers AscGAPDH-F (5′-GCAACGCGTGAG TAACTCTCA-3′) and AscGAPDH-R (5′-TGTTGA CACCCATAACGAACA-3′) were designed in this study to amplify a 496 bp PCR product from the G3PDH (glyceraldehyde 3-phosphate dehydrogenase) gene from Ascochyta species. PCR amplifications were performed in a 50 μl reaction volume using the Platinum® Pfx DNA Polymerase (Thermo Fisher Scientific Inc.). The PCR products were gel purified using a QIAquick gel extraction kit (Qiagen) and sequenced at BGI (Shanghai, China).

Liu N., Xu S., Yao X., Zhang G., Mao W., Hu Q., Feng Z, & Gong Y. (2016). Studies on the Control of Ascochyta Blight in Field Peas (Pisum sativum L.) Caused by Ascochyta pinodes in Zhejiang Province, China. Frontiers in Microbiology, 7, 481.

+ Open protocol

+ Expand

Cloning and Characterization of NHEJ1/XLF Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

A 1.62 kb region of the NHEJ1/XLF promoter, containing 1.5 kb upstream and 120 bp downstream of the NHEJ1/XLF transcription start site, was amplified from human genomic DNA using Platinum Pfx DNA Polymerase (Thermo Scientific) according to the manufacturer’s protocol. The primers used were: 5′-GATTCCTGGTAAGTTGAGGCTAGGCCCTAGC-3′ (Forward) and 5′-CTCCTGCCCGGACTCGAACGCGATTCCAC-3′ (Reverse). The amplified product was cloned into the pCR2.1-TOPO vector using the TOPO TA Cloning Kit (Invitrogen) according to the manufacturer’s protocol. The cloned sequence was confirmed by Sanger sequencing. The NHEJ1/XLF promoter was then subcloned into the pGL3-Basic Vector (Promega) using KpnI and XhoI restriction enzyme sites contained in both plasmids. The XLF promoter sequence in the pGL3 luciferase reporter vector was again confirmed by Sanger sequencing. Promoter deletions were made using the Q5 site directed mutagenesis kit (NE Biolabs) per manufacturer’s protocol.

Sulkowski P.L., Scanlon S.E., Oeck S, & Glazer P.M. (2018). PTEN Regulates Non-Homologous End Joining by Epigenetic Induction of NHEJ1/XLF. Molecular cancer research : MCR, 16(8), 1241-1254.

+ Open protocol

+ Expand

Molecular Cloning Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA preparation and related techniques were performed according to standard protocols⁵⁸. Plasmid DNA was isolated using the Wizard Plus SV Minipreps Kit (Promega). Purification of PCR products and of plasmids from agarose gels was carried out using the Wizard SV Gel and PCR Clean-Up System Kit (Promega). All restriction enzymes were purchased from Promega. T4 DNA Ligase (Promega) and Platinum Pfx DNA Polymerase (Thermo Fisher Scientific) were used according to the user manuals. The sequence of the constructs was verified by the DNA Sequencing Facility at the University of Maine (https://umaine.edu/dnaseq/).

Belluzo B.S., Abriata L.A., Giannini E., Mihovilcevic D., Dal Peraro M, & Llarrull L.I. (2019). An experiment-informed signal transduction model for the role of the Staphylococcus aureus MecR1 protein in β-lactam resistance. Scientific Reports, 9, 19558.

+ Open protocol

+ Expand

DNA Barcoding for Species Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Species determination was confirmed by amplification of the cytochrome C oxidase subunit I (COI) DNA barcode region. Genomic DNA (gDNA) was extracted from one middle leg based on the procedure described in [30 ]. Primers used for PCR amplification were LCO1490 5’-TATCAACCAATCATAAAGATATTGG and HCO2198 5’-TAAACTTCAGGGTGACCAAAAAATCA [31 (link)]. The PCR reaction mixtures contained 2 μM of each primer, 1 mM MgSO₄, 0.2 mM dNTPs, 10x Pfx amplification buffer, 1 U Platinum® Pfx DNA polymerase (Thermo Fisher Scientific, Cat. No. 11708–013) and 1 μl template gDNA. The PCR reaction conditions were 95°C for 5 min, 35 cycles of 94°C for 15 s, 50°C for 30 s, 68°C for 45 s, and a final elongation step at 68°C for 10 min. PCR products were submitted to GATC Biotech AG (Constance, Germany) for dideoxy DNA sequencing in both directions. The sequences were queried against the Barcode of Life Data (BOLD) Systems COI database for species identification [32 (link)].

Schoonvaere K., De Smet L., Smagghe G., Vierstraete A., Braeckman B.P, & de Graaf D.C. (2016). Unbiased RNA Shotgun Metagenomics in Social and Solitary Wild Bees Detects Associations with Eukaryote Parasites and New Viruses. PLoS ONE, 11(12), e0168456.

+ Open protocol

+ Expand

Molecular Cloning and Purification of Key Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!