q-PCR was conducted using the 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR Green 1 (Takara Bio, Tokyo, Japan). The relative target mRNA expression was determined using the comparative threshold (ΔCT) method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primer pairs used in this study are listed in
Sybr green 1
SYBR Green I is a nucleic acid stain used to detect and quantify double-stranded DNA (dsDNA) in various applications such as real-time PCR, DNA gel electrophoresis, and DNA sequencing. It binds to the minor groove of dsDNA, resulting in a significant increase in fluorescence emission upon binding. SYBR Green I is a sensitive and cost-effective alternative to other DNA-binding dyes.
Lab products found in correlation
187 protocols using sybr green 1
Gene Expression Profiling of ETP-ALL
q-PCR was conducted using the 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with SYBR Green 1 (Takara Bio, Tokyo, Japan). The relative target mRNA expression was determined using the comparative threshold (ΔCT) method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The primer pairs used in this study are listed in
Quantification of Osteoclast Gene Expression
Quantitative RT-PCR Analysis of Embryonic Brain Development
Primers for quantitative real-time PCR
Forward | Reverse | |
---|---|---|
Nsun5 | GAGGGAAGGGTGGATAAGG | GGCACGATGCGGATGTAG |
Cdc42 | GTTGGTGATGGTGCTGTTG | CTGTGGATAACTTAGCGGTCG |
RhoA | CATTGACAGCCCTGATAGTT | TCGTCATTCCGAAGGTCCTT |
PKC | ACCCTCGTAGAGAAGCGTGT | TGAAAGTGGAGTGAAGCTG |
GAPDH | TGGGTGTGAACCACGAG | ACCACAGTCCATGCCATCAC |
qRT-PCR Assay for lncRNA Expression
Validating RNA-seq Findings via qPCR Assays
Cyclin D1 mRNA Expression in HCC
Quantifying miR-192-5p and ALX1 mRNA
Comet Assay Protocol for DNA Damage
Quantitative PCR Analysis of IDH1 Expression
Quantifying Gene Expression in Cells
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!